Картофель вектор описание сорта отзывы: Сорт картофеля Вектор: фото, отзывы, описание, характеристики.

Содержание

Сорт картофеля Вектор: фото, отзывы, описание, характеристики.

Вектор — российский столовый сорт картофеля (Solanum tuberosum) среднего срока созревания. Получен специалистами ФГБНУ «Всероссийский научно-исследовательский институт картофельного хозяйства имени А. Г. Лорха». При выведении использовались разновидность Зарево и номерной гибрид 1977−76. В 2014-ом году был включен в госреестр селекционных достижений РФ. Допущен к культивированию в Центральном регионе страны (Брянская, Тульская, Смоленская, Владимирская, Калужская, Ивановская, Московская, Рязанская области). Отличается высокой устойчивостью к фитофторозу, хорошим выходом товарной продукции. Пригоден для переработки на чипсы.

Сразу стоит сделать маленькую оговорку. Существует сорт белорусской селекции с похожим названием — Вектар, или Вектар белорусский. В народе его принято называть «Вектор». В контексте данной статьи речь пойдет о картофеле российской селекции.

Период от момента появления полных всходов до сбора урожая занимает 80−100 суток.

Растение низкое, листового типа, стебли полупрямостоячие. Листья маленькие, промежуточного типа, темно-зеленой окраски. Цветки крупные, фиолетовые.

В одном гнезде Вектора развивается в среднем 8−13 клубнеплодов, каждый массой 92−143 грамма, количество мелочи очень незначительное. Клубни имеют овально-округлую форму. Кожура довольно крепкая, красного цвета. Мякоть на срезе светло-желтой окраски, имеет весьма плотную структуру. Глазки мелкие, залегают неглубоко.

Товарная урожайность сорта, по данным результатов проведения государственных испытаний, составляет 180−263 ц/га, что сопоставимо со стандартами Бонни и Колобок. Максимальное количество удалось получить в Тульской области — с гектара посадочной площади было собрано 403 центнера картофеля, на 195 ц/га больше показателей Аврора. По некоторым данным, потенциальная урожайность может достигать отметки 700 ц/га. Товарность на весьма высоком уровне — 90−98%, лежкость также хорошая — 95%.

Вкусовые качества у Вектора отличные. Он относится к кулинарному типу B, то есть к разновидностям со средней развариваемостью клубнеплодов. В кулинарии наш герой универсален, подходит для приготовления самых разнообразных блюд, особенно хорош в запеченном, вареном, жареном виде, а также станет отличным дополнением супов, овощных смесей и салатов. Мякоть при нарезании и тепловой обработке не теряет свой привлекательный цвет, поэтому готовое блюдо выглядит очень аппетитным.

Картофель отличается высоким содержанием крахмала в мякоти — 16,7−17,5%. В связи с этим, наш герой прекрасно подходит для промышленного производства чипсов и других продуктов переработки: мука, крахмал, сухое пюре. Также он годится для приготовления картошки фри, как в «кухонных» условиях с целью личного потребления, так и в производственных комплексах для реализации в торговые сети.

Сорт умеренно требователен к плодородию почв и климату. Лучше всего он приспособлен к условиям Центрального региона, однако и в других областях показывает хорошие результаты при должном уходе. Вектор отличается засухоустойчивостью, что делает его пригодным для выращивания в южных регионах с жарким летом. В уходе растения неприхотливы, но отлично отзываются на различные агротехнические приемы, включая поливы и подкормки, рыхление грунта, прополку сорняков, окучивание, а также профилактические мероприятия по борьбе с вредителями и болезнями.

Следует отметить один нюанс, связанный с покупкой семенного материала. Как уже упоминалось в начале, нашего героя часто путают с белорусским Вектаром, и многие огородники сами не до конца понимают, какой из этих двух растет у них на участке. Внешне они очень похожи, а вот по срокам созревания различаются — российский является среднеспелым, а белорусский — среднепоздним. Будьте внимательны при покупке семенного материала!

Картофель устойчив к вирусу скручивания листьев, полосчатой и морщинистой мозаикам, возбудителю рака. Восприимчив к золотистой цистообразующей нематоде. По заявлению оригинатора, к фитофторозу обладает высокой устойчивостью как по ботве, так и по клубням.

Вектор хорошо себя зарекомендовал как на небольших огородных участках, так и на промышленных площадях крупных агропредприятий. Особенно он ценится за весьма высокую урожайность, отличный уровень товарности, отменные вкусовые качества и большое количество крахмала в мякоти, а также за неприхотливость в уходе. Стоит отметить и устойчивость клубней к механическим повреждениям, благодаря чему они пригодны к машинной уборке. К плюсам относится и засухоустойчивость и, конечно же, неуязвимость к фитофторозу. В настоящее время сопротивляемость этому «бичу» картофеля очень важна, особенно для тех огородников, у которых нет возможности часто бывать на своем участке и вовремя осуществлять профилактические обработки, а также соблюдать севооборот.

Среди недостатков числится восприимчивость к золотистой цистообразующей нематоде. Также к минусам можно отнести требовательность к плодородию почвы, однако высокая урожайность это оправдывает. Вектор — довольно «молодой» сорт, потенциал которого ещё не до конца раскрыт, но можно с уверенностью сказать, что по своим характеристикам он не уступает многим другим, проверенным временем разновидностям.

Картофель Вектор: описание сорта, фото, отзывы

Картофель «Вектор» — столовый сорт с хорошими потребительскими качествами. Благодаря своей приспосабливаемости к почве и климату, вид подходит для выращивания на участках средней полосы и Северо-Западного региона. Кроме универсального употребления, обладает массой полезных качеств, о которых будет сказано в статье. Для полноты описания будут использованы фото картофеля сорта «Вектор» и отзывы тех, кто его выращивал.

Описание сорта


Знакомство с картофелем сорта «Вектор» следует начинать с описания характеристик овоща и отзывов огородников. Это наиболее значимая информация для тех, кто желает посадить сорт на своем участке. Потребительские качества у картофеля «Вектор» достаточно высокие, поэтому его выращивание очень выгодно.

Картофель «Вектор» относится к сортам белорусской селекции. Отличается хорошей устойчивостью к заболеваниям и способностью плодоносить в регионах с разным климатом и составом почвы. Согласно описанию, для посадки картофеля «Вектор» лучше всего подходит дерново-подзолистый и болотно-торфяной грунт, но на других почвах сорт тоже дает хороший урожай. Получен «Вектор» скрещиванием видов «Зарево» и «1977-78».

Описание сорта картофеля «Вектор» стоит начать с параметров куста. Растение среднерослое, полупрямостоячее. Листья небольшие, темно-зеленой окраски, цветы фиолетовые. На одном растении расположено 10-15 соцветий. Сорт плохо реагирует на загущенность. Несмотря на средний размер куста, следует четко выдерживать схему при посадке картофеля «Вектор».

По сроку созревания сорт картошки «Вектор» относится к среднепоздним. Формирование клубней заканчивается через 85-110 дней после посадки.

Урожайность – важная характеристика при описании картофеля «Вектор». На одном растении образуется до 14-15 качественных клубней. Средняя урожайность на полях 45 т/га, а при благоприятных условиях увеличивается до 70 т/га.
Клубни средние по размеру, розовые по цвету, овальные по форме. Масса одного составляет 120 г. Глазки на корнеплодах неглубокие, в небольшом количестве. Кожура коричневого цвета, плотная.

Вкусовые качества картофеля «Вектор» ценятся высоко. По пятибалльной системе их оценивают на 4,6 баллов. Мякоть у клубней твердая, но отличается хорошей сочностью, не темнеет при термообработке. Это позволяет использовать столовый сорт для различных целей в кулинарии. Несмотря на то что при варке картошка «Вектор» немного разваривается, клубни отлично подходят для изготовления чипсов.

Следующая достойная характеристика — картошка «Вектор» хорошо хранится. Отходы в течение зимы составляют не более 5%.

Сорт проявляет высокую устойчивость к поражению фитофторозом, вирусными инфекциями, паршой обыкновенной, альтернариозом, возбудителем рака. Однако может болеть полосчатой и морщинистой мозаикой, скручиванием листьев. Среди вредителей наиболее опасна золотая цистообразующая нематода

Достоинства и недостатки


Сгруппировать основные характеристики сорта картофеля «Вектор» лучше с помощью таблицы.

Это увеличит наглядность и поможет легче воспринять информацию.

Достоинства

Недостатки

Высокий показатель урожайности

Поздний срок созревания

Устойчивость к жаре и засухе

Высокий процент содержания крахмала в клубнях

Отличный вкус

Средняя развариваемость при варке

Универсальность применения

 

Высокий уровень лежкости и транпортабельности.

 

Устойчивость к ряду заболеваний

 

Высокая степень приспосабливаемости к составу почвы и условиям выращивания

 

Пригодность к механической уборке и переработке

 

Перечень достоинств сорта гораздо больше списка недостатков, поэтому сорт картошки «Вектор» очень популярен среди любителей овоща. Чтобы получить качественный урожай в больших объемах, нужно грамотно провести посадку.

Посадка сорта


Правильная посадка картофеля «Вектор» включает в себя несколько этапов. Каждый имеет свои нюансы и тонкости. От тщательности выполнения каждого шага зависит конечный результат – урожайность. Наиболее важными являются:

  1. Выбор посадочного материала и подготовка его к посадке.
  2. Сроки посадки.
  3. Подготовка почвы.
  4. Посадка картошки «Вектор» на участке.

Рассмотрим каждый этап подробнее.

Выбор и подготовка посадочного материала


Наиболее ответственный момент. От здоровья, качества и даже размера посадочных клубней зависит дальнейшее развитие картофельного куста. Картошку «Вектор» для посадки выбирают по нескольким критериям — размер, внешний вид и форма. Высаживать лучше всего одинаковые по размеру клубни. Оптимально выбирать не слишком маленькие или большие картофелины. По отзывам, наилучший результат получается при посадке клубней размером куриных яиц. Приветствуется ровная форма семян, без резких искривлений и заломов. На каждом экземпляре не должно быть признаков поражения вредителями или болезнями. В описании картошки сорта «Вектор» и отзывах отмечено, что на клубнях небольшое количество глазков. Но для размножения хорошо оставлять картофелины с наибольшим количеством почек.

На фото пример качественного семенного материала:

Важно! Если семена приобретены с ростками, но обламывать их категорически запрещено.

Такой прием значительно снизит всхожесть.

Есть еще один нюанс. Когда сорт «Вектор» приобретен только для размножения, то используют все имеющиеся клубни.

Чтобы ускорить процесс всхода семян, для клубней проводят предпосевную подготовку. Основной этап – проращивание. Картофелины «Вектора» укладывают в ящики или на иную ровную сухую поверхность в один слой. Через 7-10 дней на них появятся ростки. Еще быстрее проращиваются семена «Вектора», если поместить их во влажные опилки, периодически поливая водой. За 2-3 дня до погружения в землю клубни «Вектора» прогревают на солнце.

Сроки посадки


По описанию сорта и отзывам огородников, лучше всего высаживать картофель «Вектор» в мае. В начале или середине месяца – эту дату выбирают в зависимости от погодных условий и особенностей региона выращивания. Важно учесть, что температура почвы перед посадкой должна составлять не менее 10°С на глубине 10 см. До намеченного времени посадки клубни и участок уже должны быть подготовлены. Как готовят посадочный материал, мы уже описали, теперь остановимся на подготовке участка для картофеля «Вектор».

Подготовка почвы


Участок выбирается с хорошим освещением и влагопроницаемостью грунта. Если вода будет застаиваться, то культура просто сгниет.

Картофель сорта «Вектор» относится к неприхотливым видам. Но если провести грамотную подготовку участка, то урожайность значительно повышается. При этом нужно не забывать, что сорт предпочитает суглинистые почвы с нейтральной или слабокислой реакцией. Хорошо растет на черноземе и супеси. Чтобы улучшить условия для развития растений, участок готовят осенью. При перекопке добавляют органические удобрения на 1 кв. м площади в таком количестве:

  • 3-4 кг перегноя;
  • 100 г золы древесной.

В момент посадки в каждую лунку дополнительно вносят:

  • суперфосфат двойной – 15 г;
  • калий сернокислый – 12 г;
  • мочевина – 10 г.

Процесс посадки


Участок очищают от растительных остатков, сорняков и намечают гряды. Копают лунки по разметке. Глубина посадочной ямки напрямую зависит от состава грунта. На глинистом она составляет 5 см, на песчаном – 10 см.

Расстояние между кустами выдерживают в интервале 35-40 см. Междурядья оставляют около 70 см. Клубни «Вектора» помещают в лунки вверх ростками.

Засыпают почвой и разравнивают землю граблями.

Уход за кустами


В первые 2-3 недели, очень важно обеспечить картофелю условия для роста надземной части. Поэтому землю пропалывают, аккуратно рыхлят и увлажняют. До появления цветков, культура не нуждается в регулярном поливе, а вот после начала цветения ему уделяют достаточно внимания.

Важно! Допускать растрескивания земли от пересыхания недопустимо.

Сорт «Вектор» устойчив к засухе, но создавать для кустов экстремальные условия не стоит. Лучше увлажнять посадки по мере необходимости. Рассчитывают общий объем воды по потребности одного растения. На один куст необходимо расходовать 2 – 2,5 литров воды. За период вегетации сорту «Вектор» нужно обеспечить 4 полноценных полива.

Подкормки. Питание нужно вносить после первого окучивания. Понадобится развести 1ст. ложку мочевины в 10-литровом ведре и полить каждый куст «Вектора» раствором в объеме 0.5 л. Подкормку вносят после рыхления. Если картофель выращивается на удобренной почве, то часто подкармливать его не понадобится. При средней питательности грунта схема подкармливания выглядит так:

Этап

Сроки

Дозировка

№1

До начала цветения

1 ст. ложка мочевины на ведро (10 л) воды

№2

В момент бутонизации

На ведро воды 1 ст. ложка калия сульфата

№3

В период цветения картофеля

На 10 л воды 1 ст. ложка суперфосфата двойного

Вредители и болезни


При выращивании картофеля сорта «Вектор» нужно принимать меры против появления грибковых инфекций – альтернариоза, фитофтороза листьев и обыкновенной парши. К этим заболеваниям «Вектор» не имеет полной устойчивости.

Избежать болезни помогут:

  • тщательная отбраковка семян;
  • соблюдение схемы посадки, чтобы не загущать растения;
  • соблюдение севооборота на грядах;
  • профилактические опрыскивания против грибковых заболеваний.

Самый известный вредитель картошки – колорадский жук. С ним приходится бороться инсектицидами и сбором жуков вручную. Но такие паразиты, как проволочник, слизни или медведка, могут нанести не меньший урон урожаю. Против них готовят ловушки и также применяют инсектициды, руководствуясь инструкцией препарата.

Хранение урожая


Картофель сорта «Вектор» славится лежкостью. Но, чтобы он не потерял эту характеристику, совершают подготовительные мероприятия:

  • подсушивают выкопанные клубни на сухой ровной поверхности;
  • аккуратно складывают картофелины, предварительно отбирая самые качественные.

Помещение готовят заранее, обеспечивая картофелю необходимую температуру, влажность хранения и возможность проветривания.

Отзывы


Елена, г. Белгород

«Вектор» очень стабилен. Не требует особых затрат времени, сил и средств, а результата плохого у меня никогда не было. Поливаю 2 раза за сезон, подкармливаю тоже 2 раза. Обязательно пропалываю и рыхлю грядку. Конечно, работаю с помощью техники. Отлично справляется культиватор.

Вадим, г. Воронеж

«Вектор» у меня растет в поле. Урожайность отличная, хорошо работают средства механизации на уборке. Проблем не бывает. Клубни почти не травмируются. За 5 лет выращивания ни разу не приходилось бороться с болезнями по-крупному. Даже колорадский жук не способен сильно снизить урожай. Хороший сорт!

Картофель Вектор – описание сорта, фото, отзывы

Картофель Вектор появился на свет благодаря трудам ученых из ФГБНУ «Всероссийского научно-исследовательского института картофельного хозяйства имени А. Г. Лорха». Сорт классифицируется как столовый. Для создания Вектора были использованы такие виды как Зарево и гибрид 1977-76. В 2014 году Вектор внесен в Госреестр России.

Сейчас мы познакомим вас с этим сортом, представив его описание, фото и отзывы огородников, столкнувшихся с его выращиванием.

Характеристика клубня

Картофель Вектор относится к среднепоздним сортам столового типа. Для полного созревания культуре необходимо 80-100 дней (в зависимости от региона выращивания).

Характеристика клубня:

  1. Содержание крахмала в пределах 17-19%.
  2. Масса спелой картофелины – 90-145 г.
  3. Урожайность от 460 до 700 центнеров с одного гектара земли.
  4. Показатели лежкости – 97%.
  5. Цвет оболочки – кремовый.
  6. Цвет мякоти – кремовый.
  7. Форма клубня – овал.
  8. Количество картофелин в одной ямке – приблизительно 12 шт.

Клубни отличаются хорошим иммунитетом. Вектор редко поражается такими болезнями как рак и фитофтора. Но в то же время клубни неустойчивы перед таким паразитом как золотистая нематода.

Характеристика куста

Кусты довольно низкие. Ботва прямая. Стебли покрыты маленькими темно-зелеными листиками. Цветки большого размера, фиолетового оттенка.

Плюсы и минусы Вектора

Картофель имеет ряд положительных сторон. Среди главных следует отметить:

  • Высокую урожайность.
  • Хороший иммунитет.
  • Не боится длительных засух.
  • Отменные вкусовые качества.
  • Хорошие показатели транспортабельности.
  • Отличные показатели лежкости.

Есть у сорта и свои недостатки. В частности:

  • В его составе много крахмала. С одной стороны, это достоинство, для тех, кто любит разваристый картофель. С другой стороны, недостаток, так как картофель Вектор не универсален и не подходит для приготовления разных блюд.
  • Поздний срок созревания.

Правильная посадка

Выбор клубней – это ответственная процедура. От размера, качества и состояния клубня напрямую зависит то, какой в будущем будет урожай. Многие почему-то полагают, что из мелкого картофеля могут вырасти крупные корнеплоды. Это глубокое заблуждение. Чтобы урожай был не просто хорошим, а отменным, необходимо отбирать посадочный материал по следующим критериям:

  • Картофелины должны быть не меньше куриного яйца.
  • На их поверхности должны отсутствовать любые дефекты: грибковые проявления, порезы, пятна и т.д.
  • Отбираются картофелины с наибольшим количеством глазок.

Когда посадочный материал отобран, его нужно подготовить к дальнейшим работам. Подобранные корнеплоды выкладывают в ящики и проращивают. Чтобы культура быстрее дала ростки, ее засыпают опилками и поливают водой комнатной температуры.

За несколько дней до посадки клубни прогревают. Для этого их переносят с места хранения на улицу, на солнце.

Когда материал готов, проводят посадку. Огород предварительно должен быть удобрен.

Схема посадки стандартная:

  1. Между лунками – 25-30 см.
  2. Между рядками – около 70 см.

Глубина посадки до 15 см. Если выращивают на юге – глубина не более 10 см, если на севере – до 15 см.

Уход

Ухаживать за картофелем Вектор, пожалуй, проще, чем за любой другой культурой. Во-первых, картофель не особо требователен к поливам. Во-вторых, чаще всего картофель дает хороший урожай не зависимо от типа почвы (влияет только ее кислотность). В-третьих, картофель не требователен к подкормкам.

Орошение

Для получения качественного урожая достаточно всего нескольких поливов. Это значительно упрощает уход за культурой.

Первое орошение проводят после появления ботвы. Когда она поднимается на 15-20 см над уровнем почвы, молодые кустики поливают.

Второе орошение проводят после появления цветочков.

И третье, последнее орошение, выполняют перед тем, как культура отцветет. Этот период будет говорить о том, что основная фаза вегетации картофеля Вектор окончена.

Опытные садоводы не рекомендуют поливать культуру после окончания цветения, так как значительно увеличивается риск проявления фитофтороза.

Окучивание

Окучивание проводят два раза за сезон. Первый раз после того как ботва набрала достаточную высоту (в пределах 20-25 см). Второй раз, по мере ее роста. Но обычно, второе окучивание проводится через 16-24 дня после первого.

Рекомендуем прочитать: "Описание сорта картофеля Луговской"

Окучивание – полезный агротехнический процесс. Во-первых, окучивая культуру мы поддерживаем ботву от пригибания к земле. Во-вторых, окучивание вспушивает грунт, чем позволяет напитать его кислородов. В-третьих, при окучивании удаляются лишние сорняки, которые оказывают угнетающее воздействие на картошку.

Удобрение

Картофель Вектор отзывчив к подкормкам. Но их нужно проводить правильно. Так, не допускается удобрение картофеля во время активной вегетационной фазы азотосодержащими подкормками. Они стимулируют рост и при этом остановят развитие самих клубней.

Вообще, в случае с картофелем достаточно всего двух подкормок:

  1. Осенью, когда собран урожай и огород подготавливается к зимовке. В данном случае удобряется весь участок.
  2. Весной, непосредственно в лунку, во время посадки картофеля. В лунку добавляют немного перегноя или древесной золы. В отличие от осенней подкормки, эта является «прямой» то есть конкретная порция удобрения попадает на конкретный посадочный материал.

Заболевания и насекомые

Картофель Вектор имеет достаточно высокий иммунитет. Он устойчив перед рядом заболеваний. В частности, вектор не боится таких болезней как:

  1. Рак.
  2. Антракноз.
  3. Ризоктониоз клубней.
  4. Сухая фузариозная гниль.

В то время он имеет среднюю защиту от фитофтороза, альтернариоза и парши.

От паразитов Вектор не защищен в полной мере, как и любой другой сорт. Чаще всего он поражается такими паразитами как:

  • Проволочник. Это насекомое длинной до 2 см с темной головой и ярко желтым тельцем. Получил свое название благодаря тому, что чем-то напоминает кусок проволоки. Борются с паразитом специальными инсектицидами (типа Базудин) или марганцовым раствором.
  • Колорадский жук. Самый известный картофельный вредитель. Бороться с ним можно как вручную, так и с помощью специальных инсектицидов. Ручная борьба сводится к устранению яиц, которые располагаются на тыльной стороне листиков и сбору личинок со взрослыми особями.
  • Медведка. Большой паразит (до 5 см), который роет туннели и уничтожает все на своем пути. Борьба с вредителем сводится к перекапыванию грунта и добавлению в него яичной скорлупы. Также, можно использовать ряд инсектицидов, например, Рембек.
  • Слизень. Медленный моллюск, но наносящий серьезный ущерб. Проявляет наибольшую активность в темное время суток. Атакует как ботву, так и корнеплоды. Борются со слизнями яичной скорлупой. Ее раскладывают по периметру и когда паразит касается краев скорлупы, он повреждает свое брюхо. Также, используют пивные ловушки или рубероид.

Отзывы

Екатерина Юрьевна, г. Воронеж, 56 лет.

Это, наверное, один из самых стабильных сортов, с которыми я сталкивалась. Вектор не требует никаких серьезных усилий для выращивания. Сама по себе я ленивый человек, в огороде колупаться не люблю, но даже у меня получается «выжать» из Вектора хороший урожай. Делаю одно окучивание за сезон, иногда протравливаем от колорадских жуков, так как их у нас тьма тьмущая. Поливаю всего раза 2 за сезон и то не систематически, когда сильно жарит. Вкус отличный, больше всего подходит для приготовления пюре, так как очень сильно разваривается.

Иван Константинович.

Выращиваю сорт в полевых условиях, на продажу. Урожайность высокая, товарный выход тоже отличный. С паразитами проблем ноль, научился бороться с ними еще до их появления. Транспортировать Вектор легко, клубни не повреждаются при длительных перевозках. Выращиваю больше 5 лет, поэтому оценку дать могу. На рынке раскупают быстро.

Елена Викторовна.

Выращиваю его не один год. За это время могу полностью охарактеризовать сорт. Во-первых, растет даже если почву особо не удобрять. Во-вторых, в поливах особо не нуждается. Делаю 2-3 полива, в зависимости от возможности (живем в городе картошка растет на даче), и от жары. Вкус отличный, жарить, варить и делать суп можно.

описание сорта, фото, отзывы, урожайность, посадка и уход

Выбирая новую овощную культуру, огородники ориентируются на ее неприхотливость, урожайность, устойчивость к климатическим условиям и болезням. Картофель Вектор, судя по описанию и отзывам, относится именно к таким сортам.

Вкусный картофель вырастить несложно, поскольку эта культура неприхотливая

Описание сорта картофеля Вектор

Оригинаторами сорта являются белорусские селекционеры. Для создания использовали виды 1977-76 и Зарево. Сорт среднепоздний. Сбор урожая начинают спустя 85-110 суток с момента посадки клубней.

Внимание! Сначала картофель называли Вектор Белорусский.

Внешний вид кустов

Для понимания особенностей картошки сорта Вектор важно знать описание куста и плодов. Растение среднего роста, побеги полупрямостоящие. Ботва представлена небольшими темно-зелеными листьями.

По мере роста побеги начинают раскидываться. Поэтому при посадке нужно строго соблюдать расстояние, чтобы избежать загущения. В противном случае болезней и вредителей не избежать, несмотря на устойчивость сорта.

Во время цветения картофельное поле становится фиолетовым от крупных бутонов.

На каждом картофельном кусте до шести соцветий

Внимание! После цветения образуются ягоды с семенами, их выбирают из темно-зеленых плодов.

Описание плодов

Не менее важно знать, что собой представляют клубни картофеля Вектор. Они выделяются средними размерами. Масса одного экземпляра варьируется в диапазоне 90-150 г. Хотя в некоторых случаях картофелины могут быть крупнее.

Кожица плотная, нежно-розового окраса, клубни овальной формы. Глазки присутствуют, но их мало, они мелкие, поэтому при чистке не возникает проблем. Мякоть клубней сочная, светло-желтой окраски.

Один куст дает до 14 штук или 1-1,5 кг отборных клубней

Каждая картофелина содержит:

  • 17-18% крахмала;
  • 3,7% сахара;
  • 78% воды;
  • витамины и минералы.

Совет! Поскольку в клубнях Вектора много крахмала, людям с диабетом этот картофель противопоказан.

Регионы выращивания

Очень хорошо сорт плодоносит на торфяно-болотном или дерново-подзолистом грунтах. Поэтому оригинаторы рекомендовали картофель Вектор для выращивания в двух регионах:

  • в Центральном;
  • на Восточно-Европейской равнине.

Сорт так понравился овощеводам, не только дачникам, но и крупным сельхозпроизводителям, что география его выращивания значительно расширилась. Сегодня картофель Вектор можно встретить во многих регионах России.

Вкусовые качества картофеля Вектор

По оценке дегустаторов картофель Вектор получил 4,6 балла за особый, ни с чем несравнимый вкус. При варке или жарке плотная мякоть немного разваривается, но цвета не меняет.

Характеристика сорта картофеля Вектор

Перед выбором картофеля Вектор важно выявить характерные особенности сорта. Это касается не только преимуществ и недостатков, но и других параметров.

Сорт Вектор обладает морозостойкостью. Возвратные весенние заморозки молодым всходам сильно не вредят, особенно если их успели окучить. Что касается устойчивости к засухе, то она высокая. Растения могут пережить кратковременную жару и отсутствие влаги. Потеря урожая составит не более 5%.

Картофель Вектор устойчив к растрескиванию. Судя по описанию, он имеет плотную кожуру, поэтому при транспортировке не теряет товарного вида. Сорт лежкий, сохранность при соблюдении норм составляет почти 95%. При этом клубни остаются даже весной плотными, питательные, а полезные качества не исчезают.

Кулинарное назначение картофеля Вектор столовое. Любое приготовленное из него блюдо отличается отменным вкусом. В промышленных масштабах готовят картофельную муку, крахмал, сухое пюре (полуфабрикат).

Важно! Картофель подходит для приготовления чипсов.

Урожайность

По мнению огородников, занимающихся сортом не один год, Вектор является высокоурожайной культурой. С 1 кв. м собирают 4,5-6 кг клубней. При выполнении агротехники и благоприятных условиях – выше. Картофель созревает через 85-110 дней с момента посадки.

Достоинства и недостатки

Как и любое культурное растение, картофель Вектор имеет плюсы и минусы.

Оригинальный, немного сладковатый вкус сорта Вектор многим пришелся по нраву

Плюсы

  • отменная, стабильная урожайность;
  • приятный вкус;
  • неприхотливость выращивания;
  • засухо- и морозоустойчивость;
  • хороший иммунитет к бактериальным заболеваниям;
  • высокая транспортабельность и лежкость;
  • механические повреждения не наносят вреда клубням;
  • возможность уборки урожая машинами.

Минусы

  • позднее созревание клубней;
  • небольшая разваристость, так как сорт содержит много крахмала.

Правила посадки

Если говорить о посадке, то картофель Вектор практически не имеет особенностей в этом отношении. Но на некоторые нюансы все же стоит обратить внимание.

Сроки

Для получения хорошего урожая необходимо своевременно сажать картофель. Это значит, что почва к моменту работ должна прогреться. Минимальная температура не менее + 10 °С на глубине 10-12 см. На юге можно приступать к посадке в апреле, в Сибири – в конце мая.

Внимание! Опытные огородники приурочивают работы к моменту зацветания черемухи.

Подготовка посадочного материала

Семенной материал – важная составляющая будущего урожая. Подбирают здоровые клубни одного размера, примерно с куриное яйцо. Если картофель крупнее, его разрезают, оставляя на каждом кусочке хорошие ростки.

Недели за две клубни вынимают из хранилища и выставляют в теплом, хорошо освещенном помещении. Время от времени сбрызгивают водой комнатной температуры, чтобы посадочный материал не высыхал.

Лучшим материалом для посадки считают клубни, у которых ростки 3-4 см

Подготовка грядок

В отличие от других сортов, Вектор – непривередливый картофель. Он растет на любых почвах, но суглинки, супеси, чернозем подходят больше. Главное, чтобы кислотность была в пределах нормы – 4,5-5,5.

Место должно быть открытым, солнечным. Учитывать нужно севооборот. Лучшими предшественниками являются:

  • бобовые и зерновые культуры;
  • тыква и огурцы;
  • лук и чеснок;
  • кабачки и патиссоны.

Важно! После пасленовых культур посадку картофеля производить не рекомендуют, так как у этих них одинаковые болезни и вредители.

Удобрения желательно внести осенью, а весной перекопать грунт за два дня до посадки, почва должна осесть.

Правила посадки

Посадить картофель несложно, но при этом нужно соблюдать расстояние между рядами и глубину заделки клубней. В междурядьях для Вектора потребуется шаг 70 см, а клубни располагают через 35 см. Что касается заделки картофеля, то это зависит от состава грунта:

  • на легких почвах – 10-12 см;
  • на тяжелых и суглинках – 8-10 см;
  • если в составе преобладает глина, не более 5 см.

Выкапывают ямки, в которые раскладывают клубни. Потом присыпают землей. Чтобы сохранить влагу, поверхность после посадки разравнивают граблями.

Картофель нужно закладывать аккуратно, чтобы не сломать ростки

Особенности выращивания

Неприхотливый сорт Вектор – находка для дачников, которые не могут часто бывать на участках. Он не нуждается в особом уходе. Как правило, агротехнические мероприятия традиционные.

Полив и подкормка

Поливать нужно только при отсутствии дождей. Сначала при первых всходах, потом во время бутонизации и роста картофелин.

Удобрять можно после полива куриным пометом или мочевиной сразу после посадки. После проведения работ почву нужно прорыхлить.

Рыхление, прополка, окучивание

Чтобы получить хороший урожай, сорт Вектор обязательно рыхлят, удаляют траву и окучивают 2-3 раза. Такая процедура не только удерживает влагу, но и защищает клубни от солнца.

Рыхлить грунт нужно неглубоко, чтобы не повредить столоны

Вредители и заболевания

Селекционеры, создавая Вектор Белорусский, позаботились об иммунитете. Культура редко болеет: картофельным раком и нематодой, фузариозной гнилью и антракноз.

Важно! Практически не восприимчив сорт к вирусным заболеваниям.

А вот альтернариоз, фитофтороз, обыкновенная парша могут погубить урожай, если не принять меры.

Из вредителей огородники отмечают колорадского жука, проволочника, медведку и слизней. Для борьбы используют инсектициды.

Личинок колорадского жука и слизней придется убирать вручную, а на медведок ставить ловушки

Уборка и хранение урожая

Убирают картофель Вектор в августе-сентябре, в зависимости от региона выращивания. Работы проводят в сухую погоду. Собранные клубни оставляют на несколько часов на участке, а потом убирают для просушки в помещение с хорошей вентиляцией. Через две недели перебирают и отправляют в хранилище. Урожай не теряет товарного вида более восьми месяцев при соблюдении норм.

В помещении для хранения должна быть температура 10-15 °С и влажность от 60 до 70%

Заключение

Картофель Вектор пользуется популярностью у российских огородников. Сорт неприхотливый, но очень урожайный. Отличается превосходным вкусом.

Отзывы о картофеле сорта Вектор

Валентин Витальевич Перфильев, 45 лет, г. Ярославль

Сажаю картофель Вектор три года подряд. Хочу отметить, что сорт неприхотливый, при наличии дождей не требует полива. Урожайность стабильная. Клубни к моменту созревания выровненные. В каждом кусте 15 клубней, иногда и больше. Если говорить о вкусовых качествах, то они отменные, даже некоторая развариваемость не заставит отказаться от Вектора.

Сергей Иванович Мальцев, 39 лет, г. Воронеж

Занимаюсь картофелем всерьез. Выращиваю на реализацию, от желающих отбоя нет. У меня большое картофельное поле. Поэтому все работы механизированные. Клубни, слегка поврежденные при уборке машинами, быстро приходят в норму, не загнивают. Хранится сорт до нового урожая.

Валентина Павловна Чернышева, 50 лет, Забайкальский край

Хотя картофель Вектор не рекомендуют выращивать в наших условиях, я все-таки рискнула. И не жалею. Сажаю сорт уже несколько лет и очень довольна. Отдача стабильная и высокая. Вкус картошки отличный. Готовим различные блюда. Кроме того, сама делаю свой крахмал.

описание сорта, фото, характеристика, отзывы

0

1641

Рейтинг статьи

Кира Столетова

Картофель является одним из наиболее используемых овощей, без которого невозможно представить обычный рацион питания. Огородники-любители и крупные сельхозпроизводители ищут такие сорта для выращивания, которые бы имели хорошие товарные и вкусовые характеристики, а также были высокоурожайными. К таким относится сорт картофеля Вектор. Этот сорт – столовый, имеет хорошие потребительские качества. Подходит для приготовления цельной картошки, так как обладает слабой развариваемостью. Выращивать картофель Вектор не составит никакого труда, поскольку он быстро приспосабливается к погодным условиям и почве, устойчив к засухе.

Характеристика картофеля сорта Вектор

Особенности сорта

Картофель Вектор – среднепоздний, период с момента высадки до формирования корнеплодов в среднем составляет 110 дней. Урожайность меняется в пределах 250-540 ц/га.

При благоприятных погодных условиях – может достигать 670 ц/га. Уровень товарности очень высокий – в среднем 95%. В период хранения объем отходов обычно меньше 5%.

Куст

Кусты этого сорта прямые, невысокие, но при этом плохо переносят излишнюю густоту. Листья маленькие, темно-зеленого цвета.

Цветки большие, фиолетового оттенка. На одном кусте обычно вырастают от 10 до 15 соцветий.

Клубни

Корнеплоды по размеру средние, а по форме округлые или овальные, с небольшими глазками. Масса одной картошки в среднем равна 120 г. Кожура у клубней плотная, коричневого цвета с красным оттенком.

Мякоть твердая, но сочная, светло-желтого цвета. В одном корнеплоде содержится до 20% крахмала. При термообработке мякоть не темнеет. Нитраты впитывает в очень малых дозах.

Достоинства и недостатки

Описание картофеля сорта Вектор имеет схожесть с другими сортами этой культуры, но данный вид полюбился многим фермерам из-за своих достоинств. К ним можно отнести:

  • хорошие вкусовые качества;
  • высокую урожайность;
  • неприхотливость к условиям выращивания;
  • быстрая приспособляемость к условиям внешней среды;
  • длительность хранения;
  • быстрое появление урожая в первой половине вегетационного периода.

Еще одним преимуществом сорта является его устойчивость к распространенным заболеваниям пасленовых культур. К таким болезням относятся: картофельная нематода, дитиленхоз, альтернариоз, фитофтороз. Вирусам, поражающим корни и клубни, он также не поддается.

Важен и тот факт, что этот сорт идеально подходит для промышленной переработки. Из него делают чипсы, вырабатывают крахмал и спирт, а также используют в качестве корма для домашнего скота и птицы. В общей характеристике сорта картофеля Вектор недостатки не были обнаружены.

Посадка картофеля

Клубни перед посадкой необходимо прорастить

Сажать растение следует в начале мая. Земля на момент посадки должна быть прогретой до 10 см вглубь. Оптимальная температура почвы составляет 10ºC. Перед посадкой следует обработать клубни и подготовить почву согласно всем агротехническим условиям.

Будущая урожайность во многом зависит от выбранного посадочного материала. Отбирать корнеплоды на посадку лучше осенью после сбора урожая. Специалисты советуют брать большие и здоровые клубни, весом в среднем 80 г. Выбранный материал нужно хранить в светлом месте, чтобы он позеленел. Это поможет храниться ему дольше.

В конце зимы посевной материал обязательно проверяется. Образовавшиеся ростки нужно оборвать. За 30-40 дней до посадки поместите клубни в хорошо освещенное место, где температура не будет превышать 15 ºC. Когда на картофеле появятся ростки по 1 см в длину, тогда его можно сажать в грунт. Если ростки выросли раньше нужного срока, то просто спрячьте их на время в темное место.

Подготовка почвы

Самым подходящим для посадки корнеплодов будет светлый участок. Уровень кислотности почвы не должен быть завышенным, идеальным будет содержание водорода на уровне 5 рН. Также почва должна быть легкой, поскольку в тяжелом грунте клубни плохо растут из-за слабого проникновения воздуха. Особое внимание следует уделить влажности, так как при повышенном показателе посадочный материал начинает гнить.

Почву для посадки тоже подготавливают с осени. Ее необходимо тщательно перекопать, чтобы нижний слой грунта оказался на поверхности. Глубина должна достигать порядка 30 см. Следует убрать сорняки и удобрить землю. Для этого используется перегной и древесная зола. На каждый м2 внесите по 3 кг первого и 100 г второго вещества. Самыми подходящими являются суглинистый и песчаный грунты, а также чернозем.

Правила высаживания

Перед высадкой почву нужно увлажнить. Глубина лунки варьируется в зависимости от вида и состава почвы.

Если грунт глинистый, то достаточно выкопать ямку до 5 см в глубину. Если же почва в основном состоит из песка, то размер лунки должен быть не меньше 10 см. Выделяют 2 способа посадки: в лунках и гребневым методом. Первый способ используют при легкой почве, а второй – при плотной.

Если выращивать картошку в лунках, то перед тем, как поместить посадочный материал, необходимо кинуть туда немного древесной золы. Расстояние между ямками должно равняться приблизительно 30 см. Ряды должны находиться как минимум на 70 см друг от друга. Если производится гребневая посадка, то с помощью культиватора нарезаются гребни, которые должны быть по 10 см в высоту и 60 см в ширину. Погружать клубни нужно на глубину от 6 до 10 см.

Особенности ухода

Растение необходимо регулярно рыхлить

Не смотря на то, что картофель сорта Вектор неприхотлив к условиям выращивания, необходимо придерживаться некоторых правил по уходу за этим сортом, чтобы получить высокий качественный урожай. Начинать ухаживать за растением нужно еще с момента посадки. Важно, чтобы клубни обеспечивались воздухом. Для этого нужно периодически рыхлить землю и удалять сорняки.

В первое время после посадки для рыхления грунта можно использовать грабли. Но после появления ростков грядки следует разрыхлять после увлажнения почвы. Не допускайте, чтобы верхний слой земли затвердел. Другими важными аспектами ухода за культурой являются полив, прополка, удобрение почвы, обработка от насекомых и профилактика болезней.

Полив

До того момента, как на кустах начнут образовываться бутоны, растение не нужно поливать. А вот после их появления картофель нуждается в постоянном увлажнении. Важно знать, что эту культуру нельзя постоянно сильно заливать водой. Увлажнять землю нужно только, когда она просохнет приблизительно до 7 см.

Лучшим временем для полива является вечер. Для каждого куста необходимо по 2,5 л воды. Летом в жаркий период картошку нужно поливать в среднем по 4 раза в период вегетации. После этой процедуры рекомендуется рыхлить землю.

Удобрение

В качестве удобрения обычно используют навоз или куриный помет.

Если кусты плохо растут, то можно подкармливать их минеральными веществами. Очень важно, чтобы в почве соблюдался питательный баланс. Поэтому, перед тем, как вносить какие-либо удобрения, нужно посчитать объем уже имеющихся полезных веществ в почве и тех, которые вы вносили до посадки.

Если количество удобрений будет превышать норму, то дополнительная подкормка не требуется. Перенасыщение картофеля удобрениями приведет к ухудшению его качества. Если при наличии нужных органических веществ кусты все равно плохо развиваются, то проблема может быть связана с болезнями или вредителями.

Обработка от вредителей

Сорт Вектор устойчив ко многим заболеваниям, но вот от насекомых-вредителей он может пострадать.

Самым распространенным вредителем является колорадский жук. Есть несколько способов борьбы с ним, как с помощью специальных препаратов, так и с помощью народных методов.

Огородники-специалисты советуют обрабатывать землю древесной золой, которая отгоняет насекомых. Еще один хороший вариант – выращивать между картошкой календулу, бобы или фасоль. Некоторые хозяева перед массовой посадкой клубней за несколько недель сажают отдельные корнеплоды. И когда появятся ранние всходы, и на них прилетят жуки, кусты просто удаляются вместе с вредителями.

Секреты выращивания картофеля

Правильный вектор питания для огурцов в теплице. Июль 2017 г// Секреты хороших урожаев.

Уборка ячменя, 74 ц./га, сорт Маргрет 2014

Заключение

Картофель сорта Вектор имеет много достоинств, которые привлекают фермеров и массовых производителей. Вырастить его не составит труда, а в результате получаются высокие и качественные урожаи. Плоды имеют отличные вкусовые качества, благодаря чему их можно применять для приготовления любых блюд, а также использовать в пищевой промышленности.

описание и характеристики сорта, посадка и уход, отзывы с фото

Картофель сорта Вектор является белорусским «открытием», широко культивирующимся в странах СНГ. Его выращивают для личного потребления или продажи. Вкус плодов отменный, транспортабельность высокая, что позволяет перевозить их на длительные расстояния без проблем. Предварительно до посадки стоит ознакомиться со всеми нюансами разновидности.

История происхождения сорта «Вектор»

Сорт картофеля Вектор был выведен путем экспериментального скрещивания простой картошки Зарево с гибридным типом 1977-78. Патент принадлежит организации ВНИИ картофельного хозяйства имени Лорха Александра Георгиевича. В Государственном реестре, зарегистрирован подвид с 2014 года.



Описание и характеристика картошки “Вектор”

Белорусский картофель Вектор славится хорошей стойкостью к болезням, способностью приживаться почти в любых регионах, даже на Севере. Потребление универсальное, разновидность столовая, отличные вкусовые качества. Это среднепоздний сорт. Клубни формируются спустя 85-110 дней после высадки.

Куст

Растение средне рослое, полу прямостоячее. Листики мелкие, темно-зеленого тона, а соцветия пурпурные. На одном кустике присутствует 10-15 бутончиков. Картофель негативно воспринимает плотную посадку. Невзирая на размеры средней величины, важно выдерживать четко посадочную схему.

Урожайность картофеля «Вектор» и пищевая ценность клубня

Картофель сорта Вектор знаменит своим обильным урожаем, с 1 куста можно собрать до 15 достойных плодов. Средний сбор урожая с полей составляет 45 тонн с гектара, а при хорошей, идеальной погоде, возрастает до 70 т/га.

Клубни средней величины, розоватые, овальные.

Вес одного экземпляра равняется 120 граммов. Глазки неглубокие, их мало, кожура коричневатая, плотная. Дегустаторы отменно оценили вкусовые качества вида, поставив ему 4.6 баллов. Мякоть хоть и твердая, однако сочная и не меняет свой цвет на темный при термической обработке. По этой причине, сорт используют в любых кулинарных целях. При варке, картошка немного разваривается, но из нее получаются прекрасные чипсы. Овощи отлично хранятся, потеря кондиции на протяжении зимнего периода имеет максимум 5%.

Преимущества и слабые стороны

Картофель сорта Вектор предполагает множество сильных сторон, но есть негативные аспекты.

ПлюсыМинусы
Высокая урожайностьВ составе много крахмала, поэтому, картофель разваристый
Стойкость к болезням и жукамСреднепоздний период созревания
Устойчивость к засухам
Отменный вкус
Легко переживает транспортировку

Пошаговая инструкция по выращиванию картофеля

После отбора рассады, ее выкладывают в ящички и проращивают. Чтобы быстрее появились первые всходы, засыпают сверху опилками, поливают отстоявшейся водой. За 3 дня до посадочных работ, клубни прогревают. Их переносят с места хранения на улицу, ближе к солнцу.

Схема посадки картофеля следующая:

  • дистанция между лунками 25-30 см;
  • между грядками – 70 см.

Глубина ямок должна составлять 15 см. Если картофель высаживается на Юге, глубина до 10 см. На Севере она должна равняться 15 см.

Какими должны быть клубни картофеля для посадки?

От здоровья клубней зависит весь успех выращивания картофеля. Рассада должна быть размером с куриное яйцо. Если речь идет о посеве семян, идеальной их формой считается ровная, без искривлений и заломов. На каждом из них не должно быть следов поражений жуками, болезнями. Для размножения хорошо оставлять картошки с большим количеством почек.

Если семена куплены с ростками, их нельзя обламывать. Эта манипуляция снизит всхожесть.

Для ускорения прорастания семечек, для клубней осуществляют предпосевную подготовку.   Ее главным этапом является проращивание. Картофелины укладывают в ящички или на ровную, сухую поверхность в один слой. Спустя 7-10 суток, на них появляются ростки. Еще интенсивней проращиваются семечки, если их расположить во влажные опилки, поливая время от времени водой. За 2-3 дня до погружения в почву, клубни прогревают на солнце.

Выбор и подготовка посадочного участка

Картофель предпочитает расти на дерново-подзолистом и болотно-торфяном грунте. Важно, чтобы был хороший дренаж, или возрастает риск загнивания корневища. Оптимальный уровень кислотности – нейтральный или слабокислый. Картошка прекрасно растет на черноземе или супеси. Участок должен хорошо освещаться, но овощ может существовать и в полутени. Места подготавливают осенью, перекапывая землю, внося в нее органические подпитки на 1 кв.м. 3-4 кг перегноя, 100 г золы древесной. При посадке, в ямку добавляют суперфосфат двойной 15 г, сернокислый калий 12 г, мочевину 10 г.

Сроки и технология высадки картофеля

Высаживают картофель в конце апреля или первых числах мая. Выбранную территорию снова вспахивают, формируют на дистанции 40 см грядки. Клубни сажают на глубину 30 см. Их направляют вверх, присыпают 10 см слоем почвы. Тогда картофель будет быстрее расти, поскольку земля пропускает кислород. Ямки засыпают, ряды равняют, боронят граблями.

Нюансы ухода за растением

Ухаживать за картофелем Вектор несложно. Стандартный уход предполагает своевременный полив, вноску удобрений, окучивание грядок, рыхление и мульчирование почвы. Еще следует обрабатывать кусты от болезней, вредных жуков.

Полив и подкормка сорта «Вектор»

Чтобы получить достойный урожай, требуется 4-5 поливов за вегетационный период. Первое орошение делают после образования ботвы, когда она поднимается на 15 см над поверхностью. Второй раз вносят воду после формирования цветков. Третий полив приходится после цветения. В последний раз, вносить немного воды, полведра на кустик. В противном случае, повышается риск возникновения фитофтороза.

Удобрения добавляют в несколько подходов. Первый раз, после посадки. В 10 литрах воды разводят 1 литр куриного помета, или 1 ложка столовая мочевины. Поливают 0.5 литров под каждый кустик. Процедуру проводят после рыхления грунта.

Если культура слабо развилась, листики мелкие, удобряют ее в 3 этапа.

  1. До цветения вносят 1 ложку столовую сульфата калия на 10 литров воды.
  2. В ходе бутонизации, 1 ложка столовая
  3. Во время цветения, 1 ложку столовую двойного суперфосфата на 10 л воды.

На каждый кустик требуется полведра подпитки. Под картофель еще можно раскидать по десертной ложке мочевины.

Рыхление и мульчирование грунта

Землю рыхлят до посадочных работ и после них. При появлении первых всходов, проводят прополку на 5 см вглубь. Еще необходима процедура, когда растения начинают быстро расти, возникает множество сорной травы. Грунт дополнительно рыхлят при застое почвы, после ливня.

Окучивание картофельных грядок

Окучивают картофель 2 раза за вегетационный период.

  1. Первый раз, после того, как ботва набрала 20 см в высоту.
  2. Второе окучивание делают по мере роста ботвы. Обычно через 21 день после первой процедуры.

За счет окучивания, ботва не пригибается к почве, удаляются сорняки. Манипуляция вспучивает почву, она насыщается кислородом.

Какие патологии и жуки опасны картошке «Вектор»

Картофель Вектор славится стойкостью к фитофторозу, вирусам, парше, альтернариозу, раку. Иногда кусты подвергаются полосчатой и морщинистой мозаике, скручиванию листьев. Среди вредных жуков нападает золотая цистообразующая нематода. Предотвратить приведенные проблемы поможет профилактическая обработка. Ее проводят таким образом:

  • тщательно отбирают семена перед посевом;
  • соблюдают посадочные схемы, чтобы растения не загущались;
  • опрыскивают кусты от грибковых поражений специальными препаратами;
  • соблюдают севооборот.

Колорадский жук часто нападает на картофель любого сорта, от него избавляются с помощью инсектицидов, сбором вручную. Проволочник, слизни, медведки, способны нанести больший вред. Их выводят путем расставки ловушек, травлей инсектицидами.

Как правильно собирать и хранить урожай

Картофель собирают примерно в середине сентября, зависимо от срока его посадки. От этой даты отсчитывается 3.5 месяцев. Поскольку плоды с плотной кожурой, возможна механическая сборка. Чтобы картошка не утратила первозданный вид, перед хранением, ее просушивают 3 часа на свежем воздухе. Складывают плоды аккуратно, предварительно отобрав наиболее качественные экземпляры. Сберегать их следует в ящиках из дерева, в подвале, погребе.

Отзывы овощеводов о сорте «Вектор»

Отклики о картофеле Вектор положительные, они отражают реальное описание сорта.

Матвей Ревунов, 50 лет, Армавир.

Приветствую всех! Вектор – это мой любимый сорт картофеля. Выращиваю его уже 3 года на огороде для личного потребления. Обожаю готовить из плодов пюре, запеканки, рулеты. Нападал на кусты 2 раза колорадский жук, уничтожал его инсектицидами.



Иван Романов, 60 лет, Батайск.

Здравствуйте! Сосед угостил картошкой Вектор в 2015 году. Пюре настолько понравилось, что стал выращивать сорт на даче. Всем рекомендую вкуснейший, неприхотливый в уходе картофель.

характеристика и описание сорта, урожайность с фото

Среди новинок селекции овощных культур картофель Вектор, выведенный белорусскими специалистами. Получен гибридный продукт скрещиванием раннеспелых и позднеспелых видов овощного растения: картофеля Зарево и сорта 1977-78. От своих родителей Вектор получил все замечательные качества и свойства с минимумом недостатков. Ученые считают сорт лучшим для выращивания в районах с дерново-подзолистыми и торфоболотными почвами.

Описание сорта

Выбрать сорт для возделывания на фермерских полях и дачных участках можно, узнав подробно особенности овощной культуры:

  1. Вектор относится к среднеспелому типу растения, так как выкапывать клубни можно спустя 80–100 дней после посадки.
  2. Среднерослые кусты картофеля с листьями темно-зеленого окраса достигают высоты в 70–80 сантиметров. Во время цветения поле покрывается фиолетовыми бутонами. А из одной лунки выкапывают по 20 клубней бульбы.
  3. Масса клубней столового картофеля составляет от 90 до 150 грамм.
  4. Плоды с розовой кожицей и желтоватой мякотью содержат крахмала до 18 процентов.
  5.  Пригоден картофель для приготовления любых блюд. Из него получаются вкусные чипсы.

По вкусу оценивают картошку белорусской селекции на 4,7 балла из 5.

Выращивание

Готовить поле под посадку картофеля начинают осенью. Когда все овощи убраны, можно вскопать или вспахать участок. Глубокая вспашка позволит не дать остаться зимовать в грунте личинкам вредителей, спорам грибков.

Сорт картофеля Вектор неприхотлив к составу почвы, но лучше растет на суглинистом грунте с показателем кислотности в 4,5–5, 5. Обязательно вносят в период осенней вспашки удобрения. На 1 квадратный метр берут суперфосфат, сернокислый калий по 12–15 грамм и 10 грамм мочевины.

Клубни на посадку выбирают здоровые, без повреждений, массой 70–80 грамм. Их необходимо заранее прорастить, достав из подвала за месяц до посадки.

Рассаживают посадочный материал по схеме 60х60 сантиметров вглубь на 8–10 сантиметров. В лунку можно бросить пригоршню перегноя и немного древесной золы.

После посадки разравнивают поле граблями или бороной.

Особенности ухода

Во время вегетации среднеспелого типа картофеля кусты:

  • поливают по мере необходимости;
  • рыхлят междурядья 3 раза за сезон;
  • подкармливают раствором куриного помета в пропорции 1:12 или коровяком — 1:5;
  • окучивают 2 раза в летний период.

Картофель Вектор легко переносит засуху, но чтобы получить больше клубней высокого качества в жаркие периоды поливают картофельное поле.

Боронят овощную культуру до того, как появятся всходы, затем при достижении сеянцев высоты в 10–15 сантиметров. Для междурядных обработок применяют боронование во взаимно-перпендикулярных направлениях.

Кроме органических удобрений, подкармливают кусты картошки Вектор суперфосфатом (30 грамм), аммиачной селитрой (10 грамм), калийной солью (15 грамм). Разводят минеральные удобрения в 10 литрах воды. На богатых перегноем почвах можно вносить в грунт древесную золу, на бедных, песчаных – используют весь комплекс органических и минеральных удобрений, чередуя их.

Окучивание проводят во влажную погоду, нагребая землю на 8–10 сантиметров первый раз, на 18 — второй раз.

Достоинства и недостатки

Характеристика сорта картофеля Вектор содержит массу положительного. Овощную культуру выращивают из-за:

  • вкусных клубней, используемых в приготовлении разнообразных блюд;
  • высоких урожаев, достигающих 670 центнеров с гектара;
  • превосходного товарного вида плодов, сохраняющихся до 98 процентов в течение зимнего периода;
  • устойчивости к основным грибковым и бактериальным инфекциям.

К недостаткам растения относят то, что в описание сорта входит высокий уровень содержания крахмала по сравнению с другими столовыми сортами. При варке клубни часто развариваются. Отмечают и позднее созревание картофеля.

Вредители и заболевания

Картофель сорта Вектор устойчив ко многим болезням овощного растения, но при неблагоприятных условиях и отклонении от агротехнических норм выращивания, кусты поражаются:

  • фитофторозом;
  • альтернариозом;
  • паршой обыкновенной.

Идеальной средой для развития фитофторы является жара и влажность воздуха в 90 процентов. При появлении на листьях бурых пятен срочно опрыскивают растения фунгицидами типа Ридомил Голд. Операцию повторяют через 2 недели.

Альтернариоз узнают по сухим участкам на листьях. Спустя некоторое время листва отмирает, а болезнь переходит на стебли и плоды. Чтобы избавиться от инфекции, обрабатывают посевы раствором препарата Профит.

Симптомы парши выявить легко. Болезнь поражает клубни, которые покрываются язвочками, со временем сливающимися в сплошное пятно.

Для предупреждения болезней картофеля необходимо тщательнее отбирать семенной материал, протравливать клубни средством Триходермин. Большую роль в профилактике играет и соблюдение правил севооборота, при которых на одном и том же месте картошку не следует высаживать больше 2–3 лет.

Из вредителей поражается овощная культура колорадским жуком, личинки которого могут уничтожить весь урожай. Вовремя обработанные инсектицидными препаратами клубни на посадку и картофельные поля один раз за сезон — вот шаги для предупреждения нападок вредителя.

Сбор и хранение урожая

Выкапывают Вектор в сентябре, выбрав солнечный день. Клубни после сбора помещают в помещение для просушки, насыпав в 1–3 слоя. Как только картошка хорошо просохнет, здоровые клубни помещают на хранение в подвал или погреб. В помещении контролируют температуру воздуха, которая должна находиться на уровне в 1–3 градуса при влажности в 75 процентов. Если клубни будут получать приток свежего воздуха путем вентилирования, то до весны они сохранятся хорошо, без повреждений и гнили.

Можно сохранить картофель в целости, если клубни уложить на полки или ящики в 2–3 слоя, пересыпав сухими опилками. В течение зимы контролируют состояние плодов растения, убирают гнилые, пораженные болезнями.

Картофель

Вектор: описание сорта, фото, отзывы – работа по дому

2021

Картофель “Вектор” столовый сорт хорошего потребительского качества. Благодаря приспособляемости к маслу и климату, растение пригодно для выращивания в зоне средней полосы и северных широт

Содержимое

Картофель «Вектор» – столовый сорт с хорошими потребительскими качествами. Благодаря приспособляемости к почве и климату, вид пригоден для выращивания в районах средней полосы и Северо-Западного региона.Помимо универсальности использования, он обладает массой полезных качеств, о которых пойдет речь в статье. Для полноты картины будут использованы фото сорта картофеля «Вектор» и отзывы тех, кто его выращивал.

Описание сорта


Знакомство с сортом картофеля «Вектор» следует начинать с описания характеристики овоща и отзывов садоводов. Это самая важная информация для тех, кто желает посадить на своем участке сорт.Потребительские качества картофеля «Вектор» достаточно высокие, поэтому выращивание его очень рентабельно.

Картофель “Вектор” относится к сортам белорусской селекции. Отличается хорошей устойчивостью к болезням и способностью плодоносить в регионах с разным климатом и составом почвы. По описанию лучше всего для посадки картофеля Вектор подходят дерново-подзолистые и болотно-торфяные почвы, но и на других почвах сорт дает хороший урожай. Получен «Вектор» от скрещивания видов «Зарево» и «1977-78».

Описание сорта картофеля «Вектор» следует начинать с параметров куста. Растение среднерослое, полуверстое. Листья мелкие, темно-зеленого цвета, цветки пурпурные. У одного растения 10-15 соцветий. Сорт плохо реагирует на загустение. Несмотря на средний размер куста, при посадке картофеля Вектор следует четко следовать схеме.

По срокам созревания сорт картофеля “Вектор” среднепоздний. Клубникообразование заканчивается через 85-110 дней после посадки.

Урожайность – важная характеристика при описании картофеля Vector. На одном растении формируется до 14-15 качественных клубней. Средняя урожайность на полях составляет 45 т / га, а при благоприятных условиях увеличивается до 70 т / га.
Клубни среднего размера, розового цвета, овальной формы. Масса одного 120 г. Глазки на корнях мелкие, в небольшом количестве. Кожура коричневая, плотная.

Вкус картофеля «Вектор» ценится очень высоко. По пятибалльной системе они оцениваются в 4 балла.6 баллов. Мякоть клубней плотная, но имеет хорошую сочность, при термической обработке не темнеет. Это позволяет использовать разнообразие столов для различных целей приготовления пищи. Несмотря на то, что при варке картофель Вектор слегка разваривается, клубни отлично подходят для приготовления чипсов.

Следующая достойная особенность – картофель Vector в хорошем состоянии. Отходов за зиму не более 5%.

Сорт отличается высокой устойчивостью к фитофторозу, вирусным инфекциям, парше обыкновенной, альтернариозу и возбудителю рака.Однако может повредить полосатая и морщинистая мозаика, скручивание листьев. Среди вредителей наиболее опасна нематода золотистая цистовая

.

Достоинства и недостатки


Сгруппировать основные характеристики сорта картофеля «Вектор» лучше с помощью таблицы. Это повысит наглядность и упростит понимание информации.

Преимущества

Недостатки

Высокая урожайность

Позднее созревание

Устойчивость к жаре и засухе

Высокое содержание крахмала 9 в клубнях

Отличный вкус

Средняя усвояемость при варке

Универсальность применения

Высокая лежкость и транспортабельность.

Устойчивость к ряду заболеваний

Высокая степень адаптации к составу почвы и условиям произрастания

Пригодность для механической очистки и вторичной переработки

Список Достоинств сорта намного больше, чем списка недостатков, поэтому сорт картофеля «Вектор» пользуется большой популярностью у любителей овощей.Чтобы получить качественный урожай в больших объемах, нужно правильно посадить.

Посадка сортов


Правильная посадка векторного картофеля включает несколько этапов. У каждого есть свои нюансы и тонкости. Конечный результат – продуктивность – зависит от тщательности каждого шага. Наиболее важными являются:

  1. Выбор посадочного материала и подготовка его к посадке.
  2. Сроки посадки.
  3. Подготовка почвы.
  4. Посадка картофеля “Вектор” на сайте.

Рассмотрим подробнее каждый этап.

Выбор и подготовка посадочного материала


Самый ответственный момент. Дальнейшее развитие картофельного куста зависит от здоровья, качества и даже размера посадочных клубней. Картофель «Вектор» для посадки выбирается по нескольким критериям – размеру, внешнему виду и форме. Лучше всего сажать клубни одного размера. Оптимально выбирать не слишком мелкую или крупную картошку. По отзывам, лучший результат получается при посадке клубней размером с куриное яйцо.Приветствуется ровная форма семян, без резких перекосов и складок. На каждом образце не должно быть признаков поражения вредителями или болезнями. В описании сорта картофеля «Вектор» и отзывах было отмечено, что на клубнях имеется небольшое количество глазков. Но для размножения хорошо оставить картофель с наибольшим количеством бутонов.

На фото пример качественного посевного материала:

Важно! Если семена приобретаются вместе с проростками, но их откалывание категорически запрещено.

Этот прием значительно снизит всхожесть.

Есть еще один нюанс. Когда сорт «Вектор» закупается только для размножения, то используются все имеющиеся клубни.

Для ускорения прорастания семян проводится предпосевная подготовка клубней. Основной этап – проращивание. Картофель «Вектор» кладут в ящики или на другую ровную сухую поверхность в один слой. Через 7-10 дней на них появятся ростки. Семена «Вектора» прорастают еще быстрее, если поместить их во влажные опилки, периодически поливая водой.За 2-3 дня до погружения в землю клубни «Вектора» прогревают на солнце.

Сроки посадки


Судя по описанию сорта и отзывам садоводов, лучше всего высаживать картофель Вектор в мае. В начале или середине месяца – эту дату выбирают в зависимости от погодных условий и особенностей региона выращивания. Важно учитывать, что температура почвы перед посадкой должна быть не менее 10 ° С на глубине 10 см.К запланированному сроку посадки клубни и участок уже должны быть подготовлены. О том, как готовится посадочный материал, мы уже рассказывали, теперь остановимся на подготовке участка под картофель Вектор.

Подготовка почвы


Участок выбран с хорошим освещением и влагопроницаемостью почвы. Если вода застаивается, культура просто загнивает.

Картофель сорта “Вектор” относится к неприхотливым видам. Но если провести грамотную подготовку участка, то урожайность значительно возрастет.При этом нельзя забывать, что сорт предпочитает суглинистые почвы с нейтральной или слабокислой реакцией. Хорошо растет на черноземе и супеси. Чтобы улучшить условия для развития растений, участок подготавливают с осени. При перекопке вносят органические удобрения на 1 кв.м площади в таком количестве:

  • 3-4 кг перегноя;
  • 100 г древесной золы.

При посадке в каждую лунку дополнительно добавляется:

  • суперфосфат двойной – 15 г;
  • сульфат калия – 12 г;
  • мочевина – 10 г.

Посадочный процесс


Участок очищен от растительного мусора, обозначены сорняки и гребни. Выкопайте ямы по разметке. Глубина посадочной лунки напрямую зависит от состава почвы. На глине – 5 см, на песке – 10 см.

Расстояние между кустами выдерживают в пределах 35-40 см. Междурядье оставляют примерно 70 см. Клубни «Вектора» укладываются в лунки вверх.

Засыпьте землей и выровняйте землю граблями.

Уход за кустом


В первые 2-3 недели очень важно обеспечить картофелю условия для роста надземной части. Поэтому землю пропалывают, тщательно рыхлят и увлажняют. До появления цветов культура не нуждается в регулярном поливе, но после начала цветения ей уделяется достаточно внимания.

Важно! Недопустимо давать земле трескаться от высыхания.

Сорт «Вектор» засухоустойчив, но создавать для кустов экстремальные условия не стоит.Лучше всего увлажнять посадки по мере необходимости. Рассчитайте общий объем воды, необходимый для одного растения. На один куст нужно израсходовать 2 – 2,5 л воды. За период вегетации сорт «Вектор» необходимо обеспечить 4 полных полива.

Подкормка. Подкормку следует вносить после первого окучивания. Вам потребуется развести 1 ст. ложку мочевины в 10-литровое ведро и в каждый куст залить раствором «Вектор» объемом 0,5 л. Подкормку применяют после рыхления. Если картофель выращивают на удобренной почве, то его часто не нужно подкармливать.При среднем содержании питательных веществ в почве схема подкормки выглядит так:

Этап

Сроки

Дозировка

№1

До цветения

1 ст. ложки мочевины на ведро (10 л) воды

№2

В момент бутонизации

На ведро воды 1 ст.ложка сульфата калия

№3

В период цветения картофеля

На 10 л воды 1 ст. ложка двойного суперфосфата

Вредители и болезни


При выращивании картофеля сорта «Вектор» необходимо принимать меры против появления грибковых поражений – альтернариоза, фитофтороза листьев и парши обыкновенной. «Вектор» не обладает полной устойчивостью к этим заболеваниям.

Избежать болезни помогут:

  • тщательный отказ от семян;
  • соблюдение схемы посадки во избежание загущения растений;
  • соблюдение севооборота на грядах;
  • опрыскивание профилактическое против грибковых заболеваний.

Самый известный вредитель картофеля – колорадский жук. С его помощью вам придется бороться с инсектицидами и вручную собирать жуков, но не меньший урон урожаю могут нанести паразиты, такие как проволочники, слизни или медведь.Против них готовят ловушки и также применяют инсектициды, руководствуясь инструкцией к препарату.

Хранилище урожая


Картофель Vector славится своей лежкостью. Но, чтобы он не потерял эту характеристику, принимаются подготовительные меры:

  • сушат выкопанные клубни на сухой ровной поверхности;
  • аккуратно сложите картофель, предварительно выбрав самые качественные.

Помещение готовится заранее, обеспечивая картофелю необходимую температуру, влажность хранения и возможность вентиляции.

Обзоры


Селекция картофеля, устойчивого к вирусам (Solanum tuberosum): обзор традиционных и молекулярных подходов

  • Аазиз Р. и Тепфер М. (1999). Рекомбинация в РНК-вирусах и в трансгенных растениях, устойчивых к вирусам. Дж. Вирол , 80 : 1339–1346.

    CAS PubMed Google Scholar

  • Адамс, М. Дж., Антонив, Дж. Ф., Баркер, Х., Джонс, А. Т., Мурант, А. Ф. и Робинсон, Д. Дж. (1998). Описание вирусов растений на компакт-диске . AAB, Веллесборн, Великобритания

  • Анандалакшми Р., Прусс, Г. Дж., Ге, X., Марате, Р., Мэллори, А. К., Смит, Т. Х. и Вэнс, В. Б. (1998). Вирусный супрессор сайленсинга генов у растений. Proc Natl Acad Sci USA , 95 : 13079–13084, 10.1073 / pnas.95.22.13079.

    CAS Статья PubMed Google Scholar

  • Андерсон Э.Дж., Старк, Д. М., Нельсон, Р. С., Пауэлл, П. А., Тумер, Н. Э. и Бичи, Р. Н. (1989). Трансгенные растения, которые экспрессируют гены белков оболочки вируса табачной мозаики или вируса мозаики люцерны, препятствуют развитию болезней некоторых неродственных вирусов. Фитопатология , 79 : 1284–1290.

    CAS Google Scholar

  • Ангенент, Г. К., ван ден Оувеланд, Дж. М. У. и Бол, Дж. Ф. (1990). Восприимчивость к вирусной инфекции трансгенных растений, экспрессирующих структурные и неструктурные гены вируса табачной погремушки. Вирусология , 175 : 191–198.

    CAS PubMed Google Scholar

  • Остин, С., Баер, М.А. и Хельгесон, Дж. П. (1985). Перенос устойчивости к вирусу скручивания листьев картофеля от Solanum brevidens к Solanum tuberosum путем соматического слияния. Plant Sci , 39 : 75–82.

    Google Scholar

  • Баереке, М.-L. (1961). Ehrfahrungen mit einjährigen Kartoffelabbauversuchen unter starken Blattrollinfektionsbedingungen. Z PflZücht , 45 : 225–253.

    Google Scholar

  • Baerecke, M. -L. (1967). Überempfindlichkeit gegen das S-Virus in der Kartoffel in einem bolivianischen Andigena -Klon. Zûchter , 37 : 281–286.

    Google Scholar

  • Багналл, Р.Х. (1972). Устойчивость к вирусам картофеля M, S, X и вирусу Spindle tuber у клубненосных видов Solanum . Am Potato J , 49 : 342–348.

    Google Scholar

  • Багналл Р. Х. и Янг Д. А. (1972). Устойчивость картофеля к вирусу S. Am Potato J , 49 : 196–201.

    Google Scholar

  • Баркер, Х.(1987). Множественные компоненты устойчивости картофеля к вирусу скручивания листьев картофеля. Annapp Biol , 111 : 641–648.

    Google Scholar

  • Баркер, Х. (1996). Наследование устойчивости к вирусам картофеля Y и A в потомстве, полученном от сортов картофеля, содержащих ген Ry, свидетельствует о новом гене экстремальной устойчивости к ПВС. Theor Appl Genet , 93 : 710–716.

    CAS PubMed PubMed Central Google Scholar

  • Баркер, Х.(1997). Чрезвычайная устойчивость к вирусу картофеля V в клонах Solanum tuberosum , которые также устойчивы к вирусам картофеля Y и A, свидетельствует о локусе, обеспечивающем устойчивость широкого спектра. Theor Appl Genet , 95 : 1258–1262, 10.1007 / s001220050690.

    CAS Статья Google Scholar

  • Баркер Х. и Харрисон Б. Д. (1985). Ограниченное размножение вируса скручивания листьев картофеля в устойчивых генотипах картофеля. Annapp Biol , 107 : 205–212.

    Google Scholar

  • Баркер Х. и Харрисон Б. Д. (1986). Ограниченное распространение антигена вируса скручивания листьев картофеля в устойчивых генотипах картофеля и его влияние на передачу вируса тлями. Annapp Biol , 109 : 595–604.

    Google Scholar

  • Баркер, Х., Риви, Б.и МакГичи, К. Д. (1998a). Высокий уровень устойчивости картофеля к вирусу швабры картофеля, индуцированный трансформацией геном белка оболочки. Eur J Pl Pathol , 104 : 737–740.

    CAS Google Scholar

  • Баркер, Х., Риви, Б., МакГичи, К. Д. и Доусон, С. (1998b). Трансформация Nicotiana benthanmiana геном белка оболочки вируса швабры картофеля дает новый фенотип устойчивости, опосредованный белком оболочки. Взаимодействие растений с микробами Mol , 11 : 626–633.

    CAS Google Scholar

  • Баркер, Х. и Соломон, Р. М. (1990). Доказательства простого генетического контроля способности картофеля ограничивать концентрацию вируса скручивания листьев картофеля в листьях. Theor Appl Genet , 80 : 188–192.

    CAS PubMed Google Scholar

  • Баркер, Х., Соломон-Блэкберн, Р. М., Макникол, Дж. У. и Брэдшоу, Дж. Э. (1994a). Устойчивость картофеля к размножению вируса скручивания листьев картофеля находится под контролем основных генов. Theor Appl Genet , 88 : 754–758.

    CAS PubMed Google Scholar

  • Баркер, Х. и Уотерхаус, П. М. (1999). Развитие устойчивости к лютеовирусам, опосредованное генами хозяина и трансгенами, происходящими от патогенов. В: Смит, Х. Г. и Баркер, Х.(ред.) Лютеовирусы . CAB International, Уоллингфорд.

  • Баркер, Х., Вебстер, К. Д., Джолли, К. А., Риви, Б., Кумар, А. и Майо, М. А. (1994b). Повышение устойчивости к размножению вируса скручивания листьев картофеля в картофеле за счет сочетания эффектов генов-хозяев и трансгенов. Взаимодействие растений с микробами Mol , 7 : 528–530.

    CAS PubMed Google Scholar

  • Баркер, Х.и Вудфорд, Дж. А. Т. (1992). Распространение вируса скручивания листьев картофеля снижается от растений клонов картофеля, в которых накопление вируса ограничено. Annapp Biol , 121 : 345–354.

    Google Scholar

  • Барсби, Т. Л., Шепард, Дж. Ф., Кембл, Р. Дж. И Вонг, Р. (1984). Соматическая гибридизация в родах Solanum , S. tuberosum и S. brevidens . Pl Cell Rep , 3 : 165–167.

    CAS Google Scholar

  • Баулкомб, Д. (1994a). Опосредованная репликазой устойчивость, новый тип устойчивости к вирусам трансгенных растений. Trends Microbiol , 2 : 60–63.

    CAS PubMed Google Scholar

  • Баулкомб Д. ​​(1994b). Новые стратегии инженерии устойчивости растений к вирусам. Curr Opin Biotechnol , 5 : 117–124.

    CAS Google Scholar

  • Баулкомб, Д. К. (1996). Механизмы патогенетической устойчивости трансгенных растений к вирусам. Pl Cell , 8 : 1833–1844.

    CAS Google Scholar

  • Баулкомб, Д. К. (1999). Ускоренная генетика, основанная на индуцированном вирусом подавлении генов. Curr Opin Pl Biol , 2 : 109–113.

    CAS Google Scholar

  • Беклин, К., Бертоме, Р., Палауки, Ж. -К., Тепфер, М. и Вошере, Х. (1998). Заражение табака или растений Arabidopsis CMV противодействует системному посттранскрипционному подавлению невирусных (транс) генов. Вирусология , 252 : 313–317, 10.1006 / viro.1998.9457.

    Артикул PubMed Google Scholar

  • Беемстер, А.Б. Р. и Розендаал А. (1972). Вирусы картофеля: свойства и симптомы. В: de Bokx, J. A. (ed.) Вирусы картофеля и производство семенного картофеля , стр. 115–142. PUDOC, Вагенинген.

  • Бендахман, А., Каньюка, К. и Баулкомб, Д. К. (1999). Ген Rx из картофеля контролирует отдельные реакции устойчивости к вирусам и гибели клеток. Pl Cell , 11 : 781–791.

    CAS Google Scholar

  • Брэдшоу, Дж.E., Hackett, C.A., Meyer, R.C, Milbourne, D., McNicol, J. W., Phillips, M. S. et al. (1998). Идентификация маркеров AFLP и SSR, связанных с количественной устойчивостью к Globodera pallida (Stone) у тетраплоидного картофеля ( Solanum tuberosum subsp. tuberosum ) с целью селекции с помощью маркеров. Theor Appl Genet , 97 : 202–210, 10.1007 / s001220050886.

    Артикул Google Scholar

  • Брэдшоу, Дж.Э. и Маккей Г. Р. (1994). Стратегии селекции клонально размножаемого картофеля. В: Брэдшоу, Дж. Э. и Маккей, Г. Р. (ред.) Potato Genetics , стр. 467–497. CAB International, Уоллингфорд.

    Google Scholar

  • Браун, К. Дж. И Хеменуэй, К. Л. (1992). Экспрессия аминоконцевых частей полноразмерных генов вирусной репликазы в трансгенных растениях придает устойчивость к инфекции вируса Х картофеля. Pl Cell , 4 : 735–744.

    CAS Google Scholar

  • Браун, К. Р., Корсини, Д., Павек, Дж. И Томас, П. Э. (1997). Наследственность полевой устойчивости культурного картофеля к вирусу скручивания листьев. Pl Порода , 116 : 585–588.

    Google Scholar

  • Браун К. Р. и Томас П. Э. (1994). Устойчивость к вирусу скручивания листьев картофеля, полученному из Solanum chacoense , характеристика и наследование. Euphytica , 74 : 51–57.

    Google Scholar

  • Брюнинг, Г. (1998). Регулировка сайленсинга генов растений. Proc Natl Acad Sci USA , 95 : 13349–13351

    CAS PubMed Google Scholar

  • Кэдман, К. Х. (1942). Аутотетраплоидное наследование у картофеля, некоторые новые данные. Дж. Генет , 44 : 33–52, 10.1073 / пнас.95.23.13349.

    Артикул Google Scholar

  • Кэррингтон, Дж. К. и Уизем, С. А. (1998). Вирусное вторжение и защита хозяина, стратегии и контр-стратегии. Curr Opin Plant Biol , 1 : 336–341.

    CAS PubMed Google Scholar

  • Чавес Р., Браун К. Р. и Иванага М. (1988a). Перенос устойчивости к накоплению титра PLRV от Solanum etuberosum к генофонду Solanum , несущему клубень. Theor Appl Genet , 76 : 129–135.

    CAS PubMed Google Scholar

  • Чавес Р., Браун К. Р. и Иванга М. (1988b). Применение межвидовой сесквиплоидии для интрогрессии резистентности к PLRV из неклубнеплодов Solanum etuberosum в зародышевую плазму культурного картофеля. Theor Appl Genet , 76 : 497–500.

    CAS PubMed Google Scholar

  • Chuquillanqui, C.и Джонс, Р.А.С. (1980). Экспресс-метод оценки устойчивости семейств проростков картофеля к вирусу скручивания листьев картофеля. Potato Res , 23 : 121–128.

    Google Scholar

  • Кокерхэм, Г. (1943a). Селекция картофеля на устойчивость к вирусам. Ann Appl Biol , 30 : 105–108.

    Google Scholar

  • Кокерхэм, Г.(1943b). Реакции сортов картофеля на вирусы X, A, B и C. Annapp Biol , 30 : 338–344.

    Google Scholar

  • Cockerham, G. и др. (1945). Некоторые генетические аспекты устойчивости к вирусам картофеля. Annapp Biol , 32 : 280–281.

    Google Scholar

  • Кокерхэм, Г. (1952). Селекция на устойчивость к вирусам картофеля.В: Streutgers, E., Beemster, A. B. R., Walgrave, J. и van der Want, J. P. H. (eds) Proceedings of the Conference on Potato Virus Diseases, Wageningen-Lisse, 1951 , pp. 37–39. Staatsdrukkerij.

    Google Scholar

  • Кокерхэм, Г. (1955). Штаммы вируса картофеля X. In: Streutgers, E., Beemster, ABR, Walgrave, J. и van der Want, JPH (eds) Proceedings of the 2nd Conference Potato Virus Diseases , Lisse-Wageningen , 1954 , стр.89–92. Х. Винман и Зонен, Вагенинген.

  • Кокерхэм, Г. (1958). Экспериментальная селекция в отношении устойчивости к вирусам. В: Streutgers, E., Beemster, ABR, Walgrave, J. и van der Want, JPH (eds) Proceedings of the 3rd Conference Potato Virus Diseases , Lisse-Wageningen , 1957 , стр. 199–203 . Х. Винман и Зонен, Вагенинген.

  • Cockerham, G. и др. (1970). Генетические исследования устойчивости к вирусам картофеля X и Y. Наследственность , 25 : 309–348.

    Google Scholar

  • Купер Дж. И. и Джонс А. Т. (1983). Реакции растений на вирусы, предложения по употреблению терминов. Фитопатология , 73 : 127–128.

    Google Scholar

  • Дейл М.Ф. Б. и Соломон Р. М. (1988). Тест в теплице для оценки чувствительности сортов к вирусу табачной погремушки. Annapp Biol , 112 : 225–229.

    Google Scholar

  • Дэвидсон, Т. М. У. (1973). Оценка устойчивости проростков картофеля к скручиванию листьев. Potato Res , 16 : 99–108.

    Google Scholar

  • Дэвидсон, Т. М. У. (1980). Селекция на устойчивость к вирусным заболеваниям картофеля ( Solanum tuberosum ) на Шотландской селекционной станции.В: Шотландская селекционная станция, 59-й годовой отчет, , стр. 100–108.

  • Доусон, У. О. (1996). Замалчивание генов и устойчивость к вирусам, общий механизм. Trends Pl Sci , 1 : 107–108.

    Google Scholar

  • Доусон, У. О. и Хильф, М. Э. (1992). Детерминанты диапазона хозяев вирусов растений. Ann Rev Pl Physiol / Pl Mol Biol , 43 : 527–555.

    CAS Google Scholar

  • де Мэн, М.Дж. (1982). Оценка использования дигаплоидов и невосстановленных гамет в селекции для количественной устойчивости к патогенам картофеля. J Agric Sci, Camb , 99 : 79–83.

    Google Scholar

  • Дерагон, Дж. М. и Лэндри, Б. С. (1992). RAPD и другие основанные на ПЦР анализы геномов растений с использованием ДНК, выделенной из небольших листовых дисков. PCR Meth Appl , 1 : 175–180.

    CAS Google Scholar

  • Деррик, П.М. и Баркер Х. (1997). Распространение лютеовируса скручивания листьев картофеля на короткие и большие расстояния, эффекты генов-хозяев и трансгенов, придающие устойчивость к накоплению вируса в картофеле. J Gen Virol , 78 : 243–251.

    CAS PubMed Google Scholar

  • Диксон Р. А., Харрисон М. Дж. И Лэмб К. Дж. (1994). Ранние события в активации защитных реакций растений. Энн Рев Фитопатол , 32 : 479–501.

    CAS Google Scholar

  • Дзевоньска, М.А. (1986). Разработка родительских линий для селекции картофеля, устойчивого к вирусам, и сопутствующие исследования. В: Beckman, A.G.B., Louwes, K.M., Dellaert, L.M. W. и Neele, A.E.F. (ред.) Potato Research for Tomorrow , pp. 96–100. PUDOC, Вагенинген.

    Google Scholar

  • Дзевоньска, М. А. и Вай, М.(1994). Диплоидный генотип DW.84–1457, высокоустойчивый к вирусу скручивания листьев картофеля (PLRV). Potato Res , 37 : 217–224.

    Google Scholar

  • Истон, Г. Д., Ларсон, Р. Х. и Хугас, Р. У. (1958). Иммунитет к вирусу Y рода Solanum . Univ Wisc Res Bull , 205 : 1–31.

    Google Scholar

  • Эленфельдт, М.К. и Ханнеман Р. Э. (1984). Использование числа баланса эндосперма и 2n гамет для переноса экзотической зародышевой плазмы в картофель. Theor Appl Genet , 68 : 155–161.

    CAS PubMed Google Scholar

  • Инглиш, Дж. Дж., Мюллер, Э. и Баулкомб, Д. К. (1996). Подавление накопления вируса в трансгенных растениях, проявляющих молчание ядерных генов. Pl Cell , 8 : 179–188.

    CAS Google Scholar

  • Фальк, Б.В. и Брюнинг Г. (1994). Будут ли трансгенные культуры генерировать новые вирусы и новые болезни? Science , 263 : 1395–1396.

    CAS PubMed Google Scholar

  • Fehér, A., Preiszner, J., Litkey, Z., Casanádi, G. and Dudits, D. (1992). Характеристика хромосомной нестабильности у межвидовых соматических гибридов, полученных с помощью рентгеновского слияния картофеля ( Solanum tuberosum L.) и S. brevidens Phil. Theor Appl Genet , 84 : 880–890.

    PubMed Google Scholar

  • Фитчен, Дж. Х., Бичи, Р. Н. и др. (1993). Генно-инженерная защита трансгенных растений от вирусов. Ann Rev Microbiol , 47 : 739–763.

    CAS Google Scholar

  • Flanders, K. L., Hawkes, J. G., Radcliffe, E.Б. и Лауэр Ф. И. (1992). Устойчивость картофеля к насекомым, источники, эволюционные отношения, морфологическая и химическая защита и экогеографические ассоциации. Euphytica , 61 : 83–111.

    CAS Google Scholar

  • Франко-Лара, Л. и Баркер, Х. (1999). Характеристика устойчивости к накоплению вируса скручивания листьев картофеля у Solanum phureja . Euphytica , 108 : 137–144.

    Google Scholar

  • Fuchs, M., Ferreira, S. и Gonsalves, D. (1997). Управление вирусными заболеваниями с помощью классической и инженерной защиты. Мол. Pl. Патол. Он-лайн, 1997 , 0116fuchs на http://www.bspp.org.uk/mppol

  • Gase, G., Möller, K. -H. и Шенк Г. (1988). Die Bestimmung der relativen Viruskonzentration zur Einschätzung der Quantitativen Resistenz von Kartoffelgenotypen gegen das Kartoffelblattroll-Virus. Arch Phytopathol Pflanzenschutz , 24 : 163–165.

    Google Scholar

  • Гибсон Р. В., Джонс М. Г. К. и Фиш Н. (1988). Устойчивость к вирусу скручивания листьев картофеля и вирусу Y картофеля у соматических гибридов между дигаплоидом Solanum tuberosum и brevidens . Theor Appl Genet , 76 : 113–117.

    CAS PubMed Google Scholar

  • Гибсон, Р.В., Пеху, Э., Вудс, Р. Д. и Джонс, М. Г. К. (1990). Устойчивость к вирусу Y картофеля и вирусу X картофеля в Solanum brevidens . Annapp Biol , 116 : 151–156.

    Google Scholar

  • Гилберт, Дж., Спиллейн, К., Кавана, Т. А. и Баулкомб, Д. К. (1998). Выявление у картофеля резистентности к PVX, опосредованной Rx , не требует синтеза новой РНК и может включать латентный гиперчувствительный ответ. Mol Pl-Microbe Interact , 8 : 833–835.

    Google Scholar

  • Глендиннинг Д. Р. (1983). Интродукция и селекция картофеля до начала 20 века. New Phytol , 94 : 479–505.

    Google Scholar

  • Голембоски Д. Б., Ломоносов Г. П. и Зайтлин М. (1990). Растения, трансформированные последовательностью неструктурного гена вируса табачной мозаики, устойчивы к этому вирусу. Proc Natl Acad Sci USA , 87 : 6311–6315.

    CAS PubMed Google Scholar

  • Голиновски В., Томениус К. и Оксельфельт П. (1987). Ультраструктурные исследования клеток флоэмы картофеля, инфицированных вирусом скручивания листьев картофеля – сравнение двух сортов картофеля. Acta Agric Scand , 37 : 3–19.

    Google Scholar

  • Грэм, М.У., Киз П. и Уотерхаус П. М. (1995). В поисках идеального картофеля. Today’s Life Sci , 7 : 34–41.

    Google Scholar

  • Грант С. Р. (1999). Рассмотрение механизмов посттранскрипционного сайленсинга генов, разделяй и властвуй. Ячейка , 96 : 303–306.

    CAS PubMed Google Scholar

  • Хакетт, К.А., Брэдшоу, Дж. Э., Мейер, Р. К., Макникол, Дж. У., Милбурн, Д. и Во, Р. (1998). Анализ сцепления у тетраплоидных видов, имитационное исследование. Genet Res , 17 : 143–154.

    Google Scholar

  • Хямяляйнен, Дж. Х., Сорри, В. А., Ватанабе, К. Н., Гебхардт, К. и Валконен, Дж. П. Т. (1998). Молекулярное исследование участка хромосомы, контролирующего устойчивость картофеля к потивирусам Y и A картофеля. Theor Appl Genet , 96 : 1036–1043, 10.1007 / s001220050836.

    Артикул Google Scholar

  • Хямяляйнен, Дж. Х., Ватанабе, К. Н., Валконен, Дж. П. Т., Арихара, А., Плейстед, Р. Л. и Пеху, Е. (1997). Картирование и селекция с помощью маркеров для гена крайней устойчивости к вирусу картофеля Y. Theor Appl Genet , 94 : 192–197, 10.1007 / s001220050399.

    Артикул Google Scholar

  • Харрисон, Б.Д. (1981). Экология растительных вирусов, ингредиенты, взаимодействия и влияние окружающей среды. Annapp Biol , 99 : 195–209.

    Google Scholar

  • Харрисон Б. Д. и др. (1992). Генная инженерия устойчивости к вирусам, успешная генетическая алхимия. Proc R Soc Edinb , 99B (3/4) 61–77.

    Google Scholar

  • Хассаири, А., Масмуди, К., Албуи, Дж., Робалья, К., Джуллиен, М. и Эллуз, Р. (1998). Трансформация двух сортов картофеля «Spunta» и «Claustar» ( Solanum tuberosum ) геном белка оболочки вируса мозаики салата и гетерологичным иммунитетом к вирусу картофеля Y. Plant Sci Limerick , 136 : 31–42.

    CAS Google Scholar

  • Хоукс, Дж. Г. (1994). Происхождение культурного картофеля и видовые отношения.В: Брэдшоу, Дж. Э. и Маккей, Г. Р. (ред.) Potato Genetics , стр. 3–42, CAB International, Wallingford.

  • Хефферон, К. Л., Халилиан, Х. и Абухайдар, М. Г. (1997). Экспрессия белка оболочки (CP) PVY o под контролем лидерной последовательности гена PVX CP, защита в тепличных и полевых условиях от инфекции PVY o и PVY N в трех сортах картофеля. Theor Appl Genet , 94 : 287–292, 10.1007 / s001220050412.

    CAS Статья Google Scholar

  • Хельгесон, Дж. П., Хаберлах, Г. Т., Фолман, Дж. И Остин, С. (1988). Соматические слияния видов Solanum . Pl Cell Tissue Organ Cult , 12 : 185–187.

    Google Scholar

  • Hemenway, C., Fang, R.F., Kaniewski, W.K., Chua, N.H. и Tumer, N.E. (1988). Анализ механизма защиты трансгенных растений, экспрессирующих белок оболочки Х вируса картофеля или его антисмысловую РНК. EMBO J , 7 : 1273–1280.

    CAS PubMed PubMed Central Google Scholar

  • Херберс, К., Таке, Э., Хазирезаи, М., Краузе, К. -П., Мельцер, М., Роде, В. и Зонневальд, У. (1997). Экспрессия белка движения лютеовирусов в трансгенных растениях приводит к накоплению углеводов и снижению фотосинтетической способности исходных листьев. Завод J , 12 : 1045–1056.

    CAS PubMed Google Scholar

  • Хермсен, Т.Дж. Г. (1987). Эффективное использование диких и примитивных видов в селекции картофеля. В: Джеллис, Дж. Дж. И Ричардсон, Д. Э. (ред.) Производство новых сортов картофеля. Технологический прогресс , стр. 172–185. Издательство Кембриджского университета, Лондон.

    Google Scholar

  • Хермсен, Дж. Г. Т. (1994). Интрогрессия генов диких видов, включая молекулярные и клеточные подходы. В: Брэдшоу, Дж. Э. и Маккей, Г.R. (eds) Potato Genetics , стр. 515–538. pCAB International, Уоллингфорд.

    Google Scholar

  • Хермсен, Т. Дж. Г., Раманна, М. С. и Савор, З. (1981). Влияние удвоения хромосом на фертильность, мейотическое поведение и скрещиваемость Solanum etuberosum x S. pinnatisectum . Euphytica , 30 : 33–39.

    Google Scholar

  • Хиатт, А., Кафферки, Р. и Боудиш, К. (1989). Производство антител в растениях. Nature , 342 : 76–78.

    CAS PubMed Google Scholar

  • Хауэлл, П. Дж. (1977). Последние тенденции в заболеваемости вирусами тлей в Шотландии. В: Фокс, Р. А., (ред.) Проблемы борьбы с вредителями и болезнями в Северной Британии, , стр. 26–28. Шотландский научно-исследовательский институт садоводства, Данди.

    Google Scholar

  • Халл, Р.(1984). Быстрая диагностика вирусных инфекций растений путем точечной гибридизации. Trends Biotechnol , 2 : 2–2.

    Google Scholar

  • Хаттон, Э. М. (1951). Возможные генотипы, обусловливающие устойчивость к вирусу картофеля и томата. J Aust Inst Agric Sci , 17 (3), 132–138.

    Google Scholar

  • Хаттон, Э. М. и Брок, Р.Д. (1953). Реакции и полевая устойчивость некоторых сортов и гибридов картофеля к вирусу скручивания листьев. Aust J Agric Res , 4 : 256–263.

    Google Scholar

  • Хаттон, Э. М. и Уорк, Д. К. (1952). Связь между иммунитетом и локальной реакцией на вирус Х в картофеле ( Solanum tuberosum ). Austr J Sci Res , 5 : 237–243.

    CAS Google Scholar

  • Джеффрис, К.Дж. (1998). Техническое руководство ФАО / IPGRI по безопасному перемещению зародышевой плазмы, № 19. Картофель . Продовольственная и сельскохозяйственная организация Объединенных Наций / Международный институт генетических ресурсов растений, Рим.

  • Джонстон С.А. и Ханнеман Р.Э. (1982). Манипуляции с балансовым числом эндосперма преодолевают пересекающиеся барьеры между диплоидными видами Solanum . Science , 217 : 446–448.

    CAS PubMed Google Scholar

  • Джонс, Р.А. С. (1979). Устойчивость к вирусу скручивания листьев картофеля в Solanum brevidens . Potato Res , 22 : 149–152.

    Google Scholar

  • Джонс Р.А.К. (1982). Разрушение гена устойчивости к вирусу Х картофеля Nx, выделение штамма четвертой группы из штамма третьей группы. Pl Pathol , 31 : 325–331.

    Google Scholar

  • Джонс, Р.А. С. (1985). Дальнейшие исследования разрушающих устойчивость штаммов вируса картофеля X. Pl Pathol , 34 : 182–189.

    Google Scholar

  • Джонс, Р.А.С. (1990). Штаммоспецифические и вирусоспецифические реакции гиперчувствительности на заражение потивирусами у сортов картофеля. Annapp Biol , 177 : 93–105.

    Google Scholar

  • Jongedijk, E., de Schutter, A.A.J.M., Stolte, T., van Den Elzen, P.J.M и Cornelissen, B.J.C (1992). Повышение устойчивости к вирусу Х картофеля и сохранение сортовых свойств трансгенного картофеля в полевых условиях. Bio / Technology , 10 : 422–429.

    CAS PubMed Google Scholar

  • Йоргенсен, Л. Н. и Секер, Б. Дж. М. (1996). Датский план действий по пестицидам – ​​способы сокращения затрат. В: Защита сельскохозяйственных культур в Северной Великобритании 1996 ( Протоколы конференции ), стр.63–70. Шотландский научно-исследовательский институт сельскохозяйственных культур, Данди.

  • Касшау, К. Д., Кронин, С. и Кэррингтон, Дж. К. (1997). Функции амплификации генома и перемещения на большие расстояния, связанные с центральным доменом Tobacco etch potyvirus , вспомогательный компонент-протеаза. Virology , 228 : 251–262, 10.1006 / viro.1996.8368.

    CAS Статья PubMed Google Scholar

  • Кавчук, Л.М., Линч, Д. Р., Мартин, Р. Р., Козуб, Г. К. и Фэррис, Б. (1997). Полевая устойчивость к лютеовирусу скручивания листьев картофеля в трансгенных и сомаклоновых растениях картофеля снижает симптомы заболевания клубней. Can J Plant Pathol , 19 : 260–266.

    Google Scholar

  • Кавчук, Л. М., Мартин, Р. Р. и Макферсон, Дж. (1991). Смысловая и антисмысловая РНК-опосредованная устойчивость к вирусу скручивания листьев картофеля у растений картофеля Russet Burbank. Mol Pl-Microbe Interact , 4 : 247–253.

    CAS Google Scholar

  • Кодзима Р. и Лапьер Х. (1988). Вирус скручивания листьев картофеля. В: Смит, И. М., Дунез, В., Филипс, Д. Х., Лелиот, Р. А. и Арчер, С. А. (ред.) Европейский справочник по болезням растений , стр. 23–24. Научные публикации Блэквелла, Оксфорд.

    Google Scholar

  • Лоусон, К., Каневски В., Хейли Л., Розман Р., Ньюэлл К. и Сандерс П. (1990). Разработка устойчивости к смешанной вирусной инфекции у коммерческого сорта картофеля, устойчивости к вирусу X картофеля и вирусу Y картофеля у трансгенного картофеля Russet Burbank. Био / технологии , 8 : 127–134.

    CAS PubMed Google Scholar

  • Le Romancer, M. и Nedellec, M. (1997). Влияние генотипа растения, изолята вируса и температуры на проявление болезни некротической кольцевой пятнистости клубней картофеля (PTNRD). Pl Pathol , 46 : 104–111.

    Google Scholar

  • Линдбо, Дж. А. и Догерти, У. Г. (1992). Возникающая из патогенов устойчивость к потивирусу, иммунные и устойчивые фенотипы в трансгенном табаке, экспрессирующем другие формы нуклеотидной последовательности белка оболочки потивируса. Mol Pl-Microbe Interact , 5 : 144–153.

    CAS Google Scholar

  • Lodge, J.К., Каневски, В. К. и Тумер, Н. Э. (1993). Устойчивость к вирусам широкого спектра действия у трансгенных растений, экспрессирующих противовирусный белок лука. Proc Natl Acad Sci USA , 90 : 7089–7093.

    CAS PubMed Google Scholar

  • Longstaff, M., Brigneti, G., Boccard, F., Chapman, S. и Baulcombe, D. (1993). Чрезвычайная устойчивость к инфекции вируса Х картофеля у растений, экспрессирующих модифицированный компонент предполагаемой вирусной репликазы. EMBO J , 12 : 379–386.

    CAS PubMed PubMed Central Google Scholar

  • Маккензи, Д. Дж. И Тремейн, Дж. Х. (1990). Трансгенный вирус Nicotiana debneyii , экспрессирующий вирусный белок оболочки, устойчив к S-инфекции вируса картофеля. J Gen Virol , 71 : 2167–2170.

    CAS PubMed Google Scholar

  • Мальное, п., Фаринелли, Л., Колле, Г. Ф. и Реуст, В. (1994). Маломасштабные полевые испытания с трансгенным картофелем, cv. Бинтье, для проверки устойчивости к первичным и вторичным инфекциям картофельного вируса Y. Pl Mol Biol , 25 : 963–975.

    CAS Google Scholar

  • Малное П., Якаб Г., Дроз Э. и Вайстий Ф. (1997). Оценка риска, эволюция вирусной популяции трансгенных растений. В: Wirz, J. (ed) Dialogue on Risk Assessment of Transgenic Plants, Scientific, Technological and Social Perspectives.Труды 3-го семинара по генам If , Дорнах, Швейцария, октябрь 1997 г. , стр. 4–9. Если ген : Международный форум генной инженерии, Крисит, Великобритания.

  • Мендоза, Х. А., Миховилович, Э. Дж. И Сагума, Ф. (1996). Идентификация триплексных (YYYy) иммунных предшественников Y (PVY) вируса картофеля, полученных из Solanum tuberosum ssp. andigena . Am. Картофель J , 73 : 13–19.

    Google Scholar

  • Мишельмор, Р.У., Паран И. и Кессели Р. В. (1991). Идентификация маркеров, связанных с генами устойчивости к болезням, с помощью массового сегрегантного анализа, быстрого метода обнаружения маркеров в определенных геномных регионах с использованием сегрегации популяций. Proc Natl Acad Sci USA , 88 : 9828–9832.

    CAS PubMed PubMed Central Google Scholar

  • Милбурн, Д., Мейер, Р., Брэдшоу, Дж. Э., Бэрд, Э., Бонар, Н., Прован, Дж., Пауэлл, В. и Во, Р. (1997). Сравнение маркерных систем на основе ПЦР для анализа генетических родств культурного картофеля. Mol Breed , 3 : 127–136.

    CAS Google Scholar

  • Милбурн, Д., Мейер, Р. К., Коллинз, А. Дж., Рамзи, Л. Д., Гебхард, К. и Во, Р. (1998). Выделение, характеристика и картирование локусов простых повторов последовательности в картофеле. Mol Gen Genet , 259 : 233–245, 10.1007 / s004380050809.

    CAS Статья PubMed PubMed Central Google Scholar

  • Миллс, У. Р. (1965). Наследование иммунитета к вирусу картофеля X. Am Potato J , 42 : 294–295.

    Google Scholar

  • Монсанто (1994). Растения, устойчивые к заражению PLRV. Международная заявка на патент WO 94/18336 .

  • Монсанто (1997).Картофель NewLeaf. В: Руководство по биотехнологическим ресурсам. Картофель Naturemark . http: www.naturemark.com. Monsanto, 250 Bobwhite Court, Suite 300, Boise, ID 83706, США).

  • Мюллер, Э., Гилберт, Дж., Давенпорт, Г., Бринети, Г. и Баулкомб, Д. К. (1995). Гомологически зависимая устойчивость, устойчивость к трансгенным вирусам у растений, связанная с гомологически зависимым подавлением генов. Завод J , 7 : 1001–1013.

    CAS Google Scholar

  • Окамото, Д., Нильсен, С. В. С., Альбрехтсен, М. и Боркхард, Б. (1996). Общая устойчивость к вирусу Y картофеля, введенному в коммерческий сорт картофеля путем генетической трансформации геном белка оболочки PVY N . Potato Res , 39 : 271–282.

    CAS Google Scholar

  • Pierpoint, W. S. (1996). Изменение устойчивости к вирусам растений. В: Pierpoint, W. S. и Shewry, P. R. (eds) Генная инженерия сельскохозяйственных культур на предмет устойчивости к вредителям и болезням , стр.16–37. Британский совет по защите сельскохозяйственных культур, Фарнхэм, Великобритания

  • Плоег, А. Т., Матис, А., Бол, Дж. Ф., Браун, Д. Дж. Ф. и Робинсон, Д. Дж. (1993). Восприимчивость трансгенных растений табака, экспрессирующих белок оболочки вируса табачной погремушки, к передаваемому нематодами и механически инокулированному вирусу табачной погремушки. J Gen Virol , 74 : 2709–2715.

    CAS PubMed Google Scholar

  • Престинг, Г.Г., Смит, О. П. и Браун, К. Р. (1995). Устойчивость к вирусу скручивания листьев картофеля у растений картофеля, трансформированных геном белка оболочки или векторными контрольными конструкциями. Фитопатология , 85 : 436–441.

    CAS Google Scholar

  • Куайм М. (1998). Трансгенный устойчивый к вирусам картофель в Мексике, потенциальные социально-экономические последствия передачи биотехнологии с севера на юг . ISAAA Briefs нет.7–1998 ISAAA / ZEF, Бонн.

  • Querci, M., Owens, R.A., Bartolini, I., Lazarte, V. и Salazar, L.F. (1997). Доказательства гетерологичной инкапсидации вироида веретеновидных клубней картофеля в частицы вируса скручивания листьев картофеля. J Gen Virol , 78 : 1207–1211.

    CAS PubMed Google Scholar

  • Риви Б., Ариф М., Кашивазаки С., Вебстер К. Д. и Баркер Х. (1995). Иммунитет к вирусу швабры картофеля у растений Nicotiana benthamiana, экспрессирующих ген белка оболочки, эффективен против грибковых инокуляций вируса. Mol Pl-Microbe Interact , 8 : 286–291.

    CAS Google Scholar

  • Робинсон, Д. Дж. И Дейл, М. Ф. Б. (1994). Восприимчивость, резистентность и толерантность сортов картофеля к инфекции вируса табачной погремушки и болезни опрыскивания. Аспекты Appl Biol , 39 : 61–66.

    Google Scholar

  • Росс, Х. (1952). Исследования мозаичной устойчивости картофеля.В: Streutgers, E., Beemster, A. B. R., Walgrave, J. и van der Want, J. P. H. (eds) Proceedings of the Conference on Potato Virus Diseases , Wageningen, 1951 , pp. 40–47. Staatsdrukkerij.

  • Росс, Х. (1954a). Über die extreme Resistenz von Solanum acaule gegen das X-virus. Mitt Biol Bundes Land u Forstwirts Berlin , 80 : 144–145.

    Google Scholar

  • Росс, Х.(1954b). Die Vererbung der ‘Imunität’ gegen das X-virus в тетраплоидеме Solanum acaule . In: Proceedings of the 9th International Congress of Genetics , Bellagio 1953. Caryologia , 6 (Suppl.), 1128–1132.

  • Росс, Х. (1958). Virusresistenzzüchtung an der Kartoffel. Eur Potato J , 1 : 1–19.

    Google Scholar

  • Росс, Х. (1961).Uber die Vererbung von Eigenschaften für Resistenz gegen das Y- und A- virus in Solanum stoloniferum und die mögliche Bedeutung für eine allgemeine Genetik der Virusresistenz in Solanum sect. Туберариум . В: Brandes, J., Bartels, R., Völk, J. и Wetter, C. (eds) Proceedings of the 4th Conference Potato Virus Diseases, Брауншвейг, 1960, , стр. 40–49. Х. Винман и Зонен Н. В., Вагенинген.

  • Росс, Х. (1978). Способы выращивания картофеля, устойчивого к вирусам.В: Отчет конференции по планированию разработок в области борьбы с вирусными заболеваниями картофеля, Международный центр картофеля, Лима, , 1977 , стр. 93–114. Международный центр картофеля, Лима.

  • Росс, Х. (1986). Картофелеводство – проблемы и перспективы. В: Успехи в растениеводстве . J Заводская порода , 13 (доп.). Пол Парей, Берлин.

    Google Scholar

  • Саламан, Р.Н. (1921). Вырождение картофеля. В: Отчет о Международной конференции по картофелю , стр. 79–91. Королевское садоводческое общество, Лондон.

  • Саламан, Р. Н. (1938). Вирус картофеля X, его штаммы и реакции. Phil Trans R Soc B , 299 : 137–217.

    Google Scholar

  • Салазар, Л. Ф. (1981). Прогресс в исследовании PSTV. In: Report of the Planning Conference on Strategy for Virus Management, International Potato Centre , Lima , 1980 , pp.44–49. Международный центр картофеля, Лима.

  • Сано Т., Нагаяма А., Огава Т., Исида И. и Окада Ю. (1997). Трансгенный картофель, экспрессирующий двухцепочечную РНК-специфичную рибонуклеазу, устойчив к вироиду веретенообразных клубней картофеля. Nature Biotechnol , 15 : 1290–1294.

    CAS Google Scholar

  • Шульц, Э. С. и Роли, У. П. (1933). Устойчивость картофеля к скрытой мозаике.(Абстрактный). Фитопатология , 23 : 32–32.

    Google Scholar

  • Сеппянен, П., Пуска, Р., Хонканен, Дж., Тюлькина, Л. Г., Федоркин, О., Морозов, С. Ю. (1997). Движение белковой устойчивости к вирусам растений, содержащим тройной блок генов. J Gen Virol , 78 : 1241–1246.

    PubMed Google Scholar

  • Шах, Д., Lawson, C., Kaniewski, W. et al. (1994). Красновато-коричневый Бербанк генетически улучшен на устойчивость к вирусу скручивания листьев картофеля и фитофторозу. В: Седьмой международный симпозиум по взаимодействию молекулярных микробов растений , Эдинбург ( Abstracts ), S48 , p. 14.

  • Шах, Д. М., Ромменс, К. Т. М. и Бичи, Р. Н. (1995). Устойчивость трансгенных растений к болезням и насекомым; прогресс и приложения к сельскому хозяйству. Trends Biotechnol , 13 : 362–368, 10.1016 / s0167-7799 (00) 88982-9.

    CAS Статья Google Scholar

  • Шепард, Дж. Ф., Бидни, Д. и Шахин, Э. (1980). Протопласты картофеля в улучшении урожая. Наука , 208 : 17–24.

    CAS PubMed Google Scholar

  • Ши, X. М., Миллер, Х., Вершот, Дж., Кэррингтон, Дж. К. и Вэнс, В. Б. (1997). Мутации в области, кодирующей центральный домен хелперного компонента протеиназы (HC-Pro), устраняют синергизм картофельного вируса Х и потивируса. Virology , 231 : 35–42, 10.1006 / viro.1997.8488.

    CAS Статья PubMed Google Scholar

  • Соломон-Блэкберн Р. (1998). Прогресс в селекции картофеля на устойчивость к вирусным заболеваниям. Аспекты Appl Biol , 52 : 299–304.

    Google Scholar

  • Соломон-Блэкберн, Р. М. и Баркер, Х. (1993). Устойчивость к лютеовирусу скручивания листьев картофеля можно значительно повысить, комбинируя два независимых типа наследственной устойчивости. Annapp Biol , 122 : 329–336.

    Google Scholar

  • Соломон-Блэкберн, Р. М. и Баркер, Х. (2001). Обзор устойчивости основных генов хозяина к вирусам картофеля X, Y, A и V в картофеле, генах, генетике и нанесенных на карту местоположениях. Наследственность , 86 : 8–16.

    CAS PubMed Google Scholar

  • Соломон-Блэкберн, Р.М. и Маккей Г. Р. (1993). Тестирование потомства на устойчивость к вирусу Y картофеля, сравнение восприимчивых сортов картофеля для использования в тестовых скрещиваниях с устойчивыми родителями. Potato Res , 36 : 327–333.

    Google Scholar

  • Соломон-Блэкберн Р. М., Маккей Г. Р. и Браун Дж. (1994). Оценка тестов потомства проростков на устойчивость к вирусу скручивания листьев картофеля. J Agric Sci , 122 : 231–239.

    Google Scholar

  • Старк Д. М. и Бичи Р. Н. (1989). Защита от потивирусной инфекции трансгенных растений, свидетельство устойчивости широкого спектра. Био / Технология , 7 : 1257–1262.

    Google Scholar

  • Стельцнер, Г. (1950). Virusresistenz der Wildkartoffeln. Z PflZücht , 29 : 135–158.

    Google Scholar

  • świeyński, K.М. (1983). Селекция по родительской линии картофеля. Genetica (Югославия .), 15 : 243–256.

    Google Scholar

  • Свежинский, К. М. (1994). Наследование устойчивости к вирусам. В: Брэдшоу, Дж. Э. и Маккей, Г. Р. (ред.) Potato Genetics , стр. 339–363. CAB International, Уоллингфорд.

    Google Scholar

  • Свежинский, К. М., Chrzanowska, M., Dziewońska, M.A. и Waś, M. (1993). Устойчивость картофеля к вирусам. В: Jacobs, T. и Parlevliet, J. E. (eds) Durability of Disease Resistance , p. 350. Kluwer, Dordrecht.

    Google Scholar

  • Свежинский, К. М., Дзевоньска, М. А. и Островска, К. (1988). Реакция на вирус скручивания листьев картофеля (PLRV) у диплоидного картофеля. Potato Res , 31 : 289–296.

    Google Scholar

  • Свежинский, К. М., Дзевоньска, М. А. и Островска, К. (1989). Устойчивость к вирусу скручивания листьев картофеля (PLRV) у диплоидного картофеля. Pl Порода , 103 : 221–227.

    Google Scholar

  • Tacke, E., Salamini, F. и Rohde, W. (1996). Генная инженерия картофеля для защиты широкого спектра действия от вирусной инфекции. Nature Biotechnol , 14 : 1597–1601.

    CAS Google Scholar

  • Тавладораки П., Бенвенуто Э., Тринка С., де Мартинис Д., Каттанео А. и Галеффи П. (1993). Трансгенные растения, экспрессирующие функциональное одноцепочечное антитело против Fv, специфически защищены от вирусной атаки. Nature , 366 : 469–472.

    CAS PubMed Google Scholar

  • Томас П.Э., Каневски У. К. и Лоусон Э. К. (1997). Снижение полевого распространения вируса скручивания листьев картофеля в картофеле, трансформированном геном белка оболочки вируса скручивания листьев картофеля. Plant Dis , 81 : 1447–1453.

    Google Scholar

  • Томас П. Э., Каневски В. К., Рид Г. Л. и Лоусон Е. К. (1995). Трансгенная устойчивость к вирусу скручивания листьев картофеля у картофеля Russet Burbank. В: Manka, M. (ed.) Экологические биотические факторы в комплексной борьбе с болезнями растений , стр.551–554. Польское фитопатологическое общество, Познань, Польша.

  • Труве, Э., Асполлу, А., Хонканен, Дж., Пуска, Р., Мехто, М. и Хасси, А. (1993). Трансгенные растения картофеля, экспрессирующие 2′-5′-олигоаденилатсинтетазу млекопитающих, защищены от инфицирования вирусом Х картофеля в полевых условиях. Био / Технологии , 11 : 1048–1052.

    CAS PubMed Google Scholar

  • Валконен, Дж.П. Т. (1994). Природные гены и механизмы устойчивости к вирусам у культурных и диких видов картофеля ( Solanum spp.). Pl Порода , 112 : 1–16.

    Google Scholar

  • Валконен, Дж. П. Т., Джонс, М. Г. К. и Гибсон, Р. В. (1991). Устойчивость Solanum brevidens как к вирусу Y картофеля, так и к вирусу X картофеля может быть связана с медленным межклеточным распространением. J Gen Virol , 72 : 231–236.

    CAS PubMed Google Scholar

  • Валконен, Дж. П. Т., Джонс, Р. А. К., Слэк, С. А. и Ватанабе, К. Н. (1996). Специфика устойчивости картофеля к вирусу, стандартизация номенклатуры. Pl Порода , 115 : 433–438.

    Google Scholar

  • Валконен, Дж. П. Т., Сюй, Ю. -С., Рокка, В.-М., Пулли, С. и Пеху, Э. (1994). Перенос устойчивости к вирусу скручивания листьев картофеля, вирусу Y картофеля и вирусу картофеля X от Solanum brevidens к S.tuberosum посредством симметричной и сконструированной асимметричной соматической гибридизации. Annapp Biol , 124 : 351–362.

    Google Scholar

  • ван ден Бугарт Т., Ломонософф Г. П. и Дэвис Дж. У. (1998). Можем ли мы объяснить РНК-опосредованную резистентность зависимым от гомологии молчанием генов? Mol Pl-Microbe Interact , 11 : 717–723.

    Google Scholar

  • ван Ден Эльзен, П.J. M., Jongedijk, E., Melchers, L. S. и Cornelissen, B.J. C. (1993). Устойчивость к вирусам и грибкам, от лаборатории к полю. Trans R Soc B , 342 : 271–278.

    Google Scholar

  • van Den Heuvel, J. F. J. M., Dirven, J. A. A. M., van Os, G.J. и Peters, D. (1993). Приобретение вируса скручивания листьев картофеля с помощью Myzus persicae от вторично инфицированных растений картофеля различных генотипов. Potato Res , 36 : 89–96.

    Google Scholar

  • ван дер Влугт, Р.А.А. и Гольдбах, Р.В. (1993). Растения табака, трансформированные геном белка оболочки Y N вируса картофеля, защищены от различных изолятов PVY и от инфекции, опосредованной тлей. Transgenic Res , 2 : 109–114.

    Google Scholar

  • van Der Vlugt, R.A.A., Ruiter, R.K.и Р. Гольдбах (1992). Доказательства опосредованной смысловой РНК защиты от PVY N в растениях табака, трансформированных цистроном вирусного белка оболочки. Завод Мол Биол , 20 : 631–639.

    CAS PubMed Google Scholar

  • Waś, M. и Dziewońska, M.A. (1984). Реакция на ПВМ и ПВС в клонах картофеля с генами Gm и Ns. В: Winiger, F. A. и Stöckli, A. (eds) 9-я трехгодичная конференция Европейской ассоциации исследователей картофеля , Interlaken , стр.245–246. Европейская ассоциация исследований картофеля.

  • Усти, Р. Л., Брэдшоу, Дж. Э., Дейл, М. Ф. Б., Маккей, Г. Р., Филлипс, М. С. и Соломон-Блэкберн, Р. М. (1992). Тестирование потомства на устойчивость к болезням и вредителям картофеля. В: Годовой отчет Шотландского научно-исследовательского института сельскохозяйственных культур, 1991 , стр. 13–16. Шотландский научно-исследовательский институт сельскохозяйственных культур, Данди.

  • Ватанабэ, К. Н. (1994). Молекулярная генетика. В: Брэдшоу, Дж. Э. и Маккей, Г. Р.(ред.) Potato Genetics , стр. 213–235. CAB International, Уоллингфорд, Великобритания.

    Google Scholar

  • Уотерхаус, П. М., Грэм, М. В. и Ван, М. – Б. (1998). Устойчивость к вирусам и молчание генов у растений могут быть вызваны одновременной экспрессией смысловой и антисмысловой РНК. Proc Natl Acad Sci USA , 95 : 13,959–13,964.

    CAS Google Scholar

  • Wiersema, H.Т. (1972). Разведение на сопротивление. В: de Bokx, J. A. (ed.) Вирусы картофеля и производства семенного картофеля , стр. 174–187. PUDOC, Вагенинген.

    Google Scholar

  • Уилсон, Т.М.А. (1993). Стратегии защиты сельскохозяйственных культур от вирусов, устойчивых цветков, вызываемых патогенами. Proc Natl Acad Sci USA , 90 : 3134–3141.

    CAS PubMed Google Scholar

  • Уилсон, К.Р. и Джонс, Р. А. С. (1992). Устойчивость к транспорту флоэмы вируса скручивания листьев картофеля в растениях картофеля. J Gen Virol , 73 : 3219–3224.

    PubMed Google Scholar

  • Уилсон, К. Р. и Джонс, Р. А. С. (1993). Устойчивость к инфекции и накоплению вируса скручивания листьев картофеля в сортах картофеля, а также влияние предшествующей инфекции другими вирусами на проявление устойчивости. Aust J Agric Res , 44 : 1891–1904.

    Google Scholar

  • Ксенофонтос, С., Робинсон, Д. Дж., Дейл, М. Ф. Б. и Браун, Д. Дж. Ф. (1998). Доказательства стойкой бессимптомной инфекции некоторых сортов картофеля вирусом табачной погремушки. Potato Res , 41 : 255–265.

    Google Scholar

  • Ян, X. C., Yie, Y., Zhu, F., Liu, Y., Kang, L. Y. и Wang, X. F. (1997). Высокая устойчивость, опосредованная рибозимом, против вироида веретеновидных клубней картофеля у трансгенного картофеля. Proc Natl Acad Sci USA , 94 : 4861–4865, 10.1073 / pnas.94.10.4861.

    CAS Статья PubMed Google Scholar

  • Янг, Н. Д. и Танксли, С. Д. (1989). ПДРФ-анализ размера хромосомных сегментов, сохраняемых вокруг локуса Tm-2 томата во время обратного скрещивания. Theor Appl Genet , 77 : 353–359.

    CAS PubMed Google Scholar

  • Циммерманн, С., Шилберг, С., Ляо, Ю.С. и Фишер, Р. (1998). Внутриклеточная экспрессия ВТМ-специфичных одноцепочечных фрагментов Fv приводит к повышению устойчивости к вирусу у Nicotiana tabacum . Mol Breed , 4 (4) 369–379.

    CAS Google Scholar

  • Руководство по борьбе с вредителями / Программа IPM штата UC (UC IPM)

    Симптомы и признаки

    Характер и тяжесть симптомов скручивания листьев зависят от вируса. штамм, сорт картофеля, окружающая среда, время и источник инфекции.Растения с хронической (семенной клубнебарный) инфекции наиболее сильно страдают. Обычно они отстают в росте и выглядят более прямостоячий. Нижние листья закатываются по краям вверх, имеют жесткую кожистую текстуры и может преждевременно умереть. Напротив, растения, которые заражаются В текущем сезоне тлей переносчики вируса скручивания листьев картофеля нормально развиваются симптомы сначала проявляются у верхних (самых молодых) листьев; листья становятся прямостоячими ориентации, становятся хлоротичными и перекатываются вверх.Поздние инфекции не всегда сопровождаются симптомами. Картофель Вирус скручивания листьев может вызывать некротическую сетку (чистую necrosis) в сосудистой ткани клубня некоторых разновидностей, включая Russet Burbank.

    Комментарии к болезни

    Вирус скручивания листьев картофеля может быть занесен на картофельное поле зараженными семенными клубнями или тлей, питавшейся инфицированными растениями картофеля. Самый эффективный переносчик вируса – зеленая персиковая тля.Для заражения вирусом тли-переносчику требуется от нескольких минут до часов, но после того, как вирус был приобретен, тля несет вирус на всю жизнь. Крылатые тли, переносимые воздушными потоками, распространяют вирус на большие расстояния между полями, в то время как тля без крыльев играет важную роль в распространении от растения к растению. При кормлении тлей вирус скручивания листьев картофеля попадает в ткань флоэмы, где вирус размножается, распространяется и вызывает заболевание. Вирус скручивания листьев картофеля не передается механически через механизмы или при контакте с листьями.

    Менеджмент

    Используйте сертифицированные семена клубни. Контролировать источники вируса, в том числе картофель-добровольцев и разбросанные растения картофеля, инфицированные вирусом скручивания листьев картофеля на ранней стадии вегетационный период. Полная устойчивость растений к вирусу скручивания листьев картофеля отсутствует. доступны в популярных разновидностях, но многие доступные разновидности не развиваются некроз клубневой сетки.

    Химический контроль Вирус скручивания листьев картофеля направлен на борьбу с тлей, чтобы уменьшить распространение вируса в поле.Применяйте инсектициды с начала до середины сезона, если: присутствуют тли и вирус скручивания листьев картофеля. В конце сезона борьба с переносчиками может не приносят экономической выгоды, если сорт картофеля невосприимчив к клубневой сетке некроз. См. APHIDS для получения дополнительной информации о борьбе с тлей.

    Руководство UC IPM по борьбе с вредителями: картофель
    Публикация UC ANR 3463

    J. Nuñez (заслуженный), UC Cooperative Extension, Kern County

    B.Дж. Эгертер, UC Cooperative Extension, округ Сан-Хоакин,

    Благодарность за вклад в развитие болезней

    Р.М. Дэвис (заслуженный), Патология растений, Калифорнийский университет в Дэвисе

    К. Смарт, Патология растений, Калифорнийский университет в Дэвисе

    Текст обновлен: 19.03

    (PDF) Обзорная статья о вирусе скручивания листьев картофеля (PLRV) картофеля в Пакистане

    Обзорная статья Asian J Agri Biol, 2016, 4 (3): 77-86.

    83

    Полная последовательность генома картофеля

    Изоляты вируса скручивания листьев, заражающие картофель в

    различных географических регионах Индии

    демонстрирует низкий уровень генетического разнообразия.

    Indian J. Virol. 24: 199-204.

    Kaiser WJ, 1980. Использование термотерапии для освобождения

    клубней картофеля от мозаики люцерны,

    вирусов катышка

    и черных кольцевых вирусов томатов. J.

    Phytopathol. 70: 1119-1122.

    Кассанис Б., 1950. Тепловая инактивация скручивания листьев

    вирус в клубнях картофеля. Аня. Прил. Биол.

    37 (3): 339-41.

    Хан М.А. и Аббас В., 2008. Множественные модели регрессии

    , основанные на

    эпидемиологических факторах, для прогнозирования

    M.persicae популяция и болезнь PLRV

    Заболеваемость

    . Int. Nat. Конф. Ученые-растениеводы,

    ICPS, 155-168.

    Коцампигикис А., Христова Д. и Тошева –

    Терзиева Е., 2008. Распространение вируса скручивания листьев

    картофеля (PLRV) и вируса картофеля Y –

    (PVYN) в полевом эксперименте. Bulg. J.

    Сельское хозяйство. Sci. 14: 56-67.

    Лобенштейн Г. и Ракка Б., 1980. Борьба с

    непостоянно передаваемых тлей

    вирусов.Фитопаразитики. 8: 221-235.

    Massalski PR и Harrison BD, 1987.

    Свойства моноклональных антител к лютеовирусу скручивания листьев

    и их применение к

    позволяет различать изоляты вируса, различающиеся по трансмиссивности тлей

    . J Gen. Virol. 68: 18-21.

    Mayo MA, Jolly CA, Duncan GH, Lamb JW

    и Hay RT, 1993. Экспериментальные подходы

    к определению роли белков

    в частицах PLRV.Шотландский

    Научно-исследовательский институт сельскохозяйственных культур. 97-100.

    Миллер В.А., Браун С.М. и Ван С., 1997.

    Новая пунктуация генетического кода:

    Экспрессия гена лютеовируса. J. Gen. Virol.

    8: 3-13.

    Милошевич Д., 1996. Эффективность масла и инсектицидов

    в защите растений картофеля

    против заражения картофельным вирусом y и

    вирусом скручивания листьев картофеля (PVY и PLRV),

    Zastita Bilja.47: 333-342.

    Милошевич Д., Стаменкович С. и Перич П., 2012.

    Возможное использование инсектицидов и минеральных масел

    масел для борьбы с передачей основных

    Вирусов картофеля, передаваемых тлей. Пестик.

    Фитомед. (Белград). 27: 97-106.

    Мирза М.С., 1978. Роль тлей в

    распространении вирусных болезней картофеля на равнинах

    Пакистана. Картофельные исследования в Пакистане.

    Шах М.А (ред.), Пак. Agric. Res. Совет.

    29-32.

    Mowry TM, 2005. Инсектицидное снижение

    Передача вируса скручивания листьев картофеля Myzus

    persicae. Аня. приложение Биол. 146: 81-88.

    Mowry TM, 1994. Вирус скручивания листьев картофеля

    Управление на северо-западе Тихого океана

    (США). С. 111-123. В Zehnder GW,

    Powelson ML, Jansson RK и Raman

    KV (ред.). Достижения в области борьбы с вредителями картофеля

    Биология и борьба с вредителями.APS Press,

    Сент-Пол.

    Могал С.М. и Халид С., 1985. Вирусные болезни

    в связи с производством картофеля в Пакистане.

    На национальном семинаре по картофелю в Пакистане,

    Исламабад (Пакистан), 2-4 апреля 1985 г.

    PARC.

    Olubyo F, Kibaru A, Nderitu J, Njeru R и

    Kasina M, 2010. Борьба с тлей

    и их векторными болезнями на семенах

    картофеля в Кении с использованием синтетических инсектицидов

    , минеральных масел и экстрактов растений.

    J. Inov. Dev. Strtegy. 4: 1-5.

    Остервельд П., 1987. Инспекция и сортировка. В

    J.A. де Боккс и J.P.H. van der Want

    (ред.) Вирусы картофеля и семенного картофеля

    Производство

    , Вагенинген, Нидерланды:

    Pudoc. 204-214.

    Питер Е.Т., Клифф Е.Л., Джеймс Ч.З., Гэри Л.Р. и

    Войцех К.К., 2000. Чрезвычайная устойчивость к вирусу скручивания листьев

    у сорта картофеля. Russet

    Burbank, опосредованный геном вирусной репликазы

    .Вир. Res. J. 71: 49-62.

    Prfifer D, Tacke E, Schmitz J, Kull D,

    Kaufmann A and Rohde W., 1992.

    Рибосомный сдвиг рамки у растений: новый сигнал

    управляет сдвигом рамки в синтезе

    предполагаемой вирусной репликазы картофель

    лютеовирус скручивания листьев. Embo. J. 11: 11-17.

    Рэдлифф, Э.Б. и Рэгсдейл Д.В., 2002. Aphid-

    передаваемых вирусов картофеля: важность

    понимания биологии переносчиков.Американский

    Журнал исследований картофеля. 79: 352-286.

    Ragsdale DW, Radcliffe EB и Difonzo CD,

    2001. Эпидемиология и полевой контроль

    PVY и PLRV. Стр. 237-270. В

    Loebenstein G, Berger PH, Brunt AA и

    Lawson RH (ред.), Вирусы и вирусоподобные болезни

    картофеля и производство

    семенного картофеля. Kluwer Academic

    Publishers, Дордрехт.

    Ragsdale DW, Radcliffe EB, Difonzo CD и

    Connelly MS, 1994.Пороговые значения действий для

    и тли – переносчика вируса скручивания листьев картофеля, –

    в отношении достижений в области биологии картофельных вредителей и

    борьбы с вредителями. Американское фитопатологическое общество

    , Миннесота, США. 99-110

    Выращивание картофеля, устойчивого к фитофторозу, методом цисгенного штабелирования | BMC Biotechnology

  • 1.

    Muller KO, Black W: Селекция картофеля на устойчивость к фитофторозу и вирусным заболеваниям в течение последних ста лет. Z Pflanzenzuchtg. 1951, 31: 305-318.

    Google Scholar

  • 2.

    Malcolmson JF, Black W: Новые гены R в Solanum demissum Lindl. и дополняющие их расы Phytophthora infestans (Mont.) de Bary. Euphytica. 1966, 15: 199-203.

    Артикул Google Scholar

  • 3.

    Малькольмсон Дж. Ф .: Расы Phytophthora infestans , встречающиеся в Великобритании.Trans Br Mycol Soc. 1969, 53: 417-423.

    Артикул Google Scholar

  • 4.

    Bradshaw JE, Bryan GJ, Lees AK, McLean K, Solomon-Blackburn RM: Картирование генов R10 и R11 устойчивости к фитофторозу ( Phytophthora infestans ), присутствующих в картофеле ( Solanum tuberosum ) R генные дифференциалы Блэка. Theor Appl Genet. 2006, 112: 744-751.

    Артикул CAS Google Scholar

  • 5.

    Wastie RL: Разведение для сопротивления. Adv Plant Pathol. 1991, 7: 193-224.

    Google Scholar

  • 6.

    Que Q, Chilton MDM, Fontes CM D, He C, Nuccio M, Zhu T, Wu Y, Chen JS, Shi L: Совмещение признаков в трансгенных культурах: проблемы и возможности. ГМ-культуры. 2010, 1: 220-229.

    Артикул Google Scholar

  • 7.

    Стрэндж Р.Н., Скотт ПР: БОЛЕЗНИ РАСТЕНИЙ: угроза глобальной продовольственной безопасности.Анну Рев Фитопатол. 2005, 43: 83-116.

    Артикул CAS Google Scholar

  • 8.

    Tomczynska I, Stefanczyk E, Chmielarz M, Karasiewicz B, Kaminski P, Jones JD, Lees AK, Sliwka J: Локус, придающий эффективную устойчивость к фитофторозу у сорта картофеля Sarpo Mira, отображается на хромосоме XI. Theor Appl Genet. 2014, 127 (3): 647-657.

    Артикул Google Scholar

  • 9.

    Rietman H, Bijsterbosch G, Cano LM, Lee HR, Vossen JH, Jacobsen E, Visser RGF, Kamoun S, Vleeshouwers VGAA: качественная и количественная устойчивость к фитофторозу у сорта картофеля Sarpo Mira определяется восприятием пяти различных эффекторов RXLR. . Mol Plant Microbe Interactive. 2012, 25 (7): 910-919.

    Артикул CAS Google Scholar

  • 10.

    Song J, Bradeen JM, Naess SK, Raasch JA, Wielgus SW, Haberlach GT, Liu J, Kuang H, Austin-Phillips S, Buell CR, Helgeson JP, Jiang J: Gene RB клонирован из Solanum bulbocastanum обеспечивает устойчивость к фитофторозу картофеля широкого спектра действия.Proc Natl Acad Sci U S. A. 2003, 100: 9128-9133.

    Артикул CAS Google Scholar

  • 11.

    van der Vossen EAG, Sikkema A, te Lintel HB, Gros J, Stevens P, Muskens M, Wouters D, Pereira A, Stiekema WJ, Allefs S: древний ген R из диких видов картофеля. Solanum bulbocastanum придает устойчивость широкого спектра к фитофторозу Phytophthora infestans у культурных картофеля и томатов. Плант Дж. 2003, 36: 867-882.

    Артикул CAS Google Scholar

  • 12.

    van der Vossen EAG, Gros JE, Sikkema A, Muskens M, Wouters D, Wolters P, Pereira A, Allefs S: ген Rpi-blb2 из Solanum bulbocastanum – это Mi-1. Гомолог гена , обеспечивающий устойчивость к фитофторозу широкого спектра действия у картофеля. Плант Дж. 2005, 44: 208-222.

    Артикул CAS Google Scholar

  • 13.

    Vleeshouwers VGAA, Rietman H, Krenek P, Champouret N, Young C, Oh SK, Wang M, Bouwmeester K, Vosman B, Visser RGF, Jacobsen E, Govers F, Kamoun S, van der Vossen EAG: Эффекторная геномика ускоряет открытия и функциональное профилирование устойчивости картофеля к болезням и Phytophthora infestans генов авирулентности. PLoS ONE. 2008, 3: e2875-

    Статья Google Scholar

  • 14.

    Lokossou AA, Park TH, Van Arkel G, Arens M, Ruyter-Spira C, Morales J, Whisson SC, Birch PRJ, Visser RGF, Jacobsen E, van der Vossen EAG: Использование знаний R / Гены Avr для быстрого клонирования нового семейства LZ-NBS-LRR генов устойчивости к фитофторозу из группы сцепления картофеля IV.Mol Plant Microbe Interactive. 2009, 22: 630-641.

    Артикул CAS Google Scholar

  • 15.

    Vossen JH, Nijenhuis M, Arens de Reuver MJB, Van der Vossen EAG, Jacobsen E, Visser RGF: Клонирование и использование функционального гена R из Solanum chacoense . Заявка на патент, опубликованная: IPO: PCT / NL2010 / 050612

  • 16.

    Pel MA, Foster SJ, Park TH, Rietman H, Van Arkel G, Jones JDG, Eck HJ V, Jacobsen E, Visser RGF, Vossen EAG Ван Д: Картирование и клонирование генов устойчивости к фитофторозу из Solanum venturii с использованием межвидового подхода к генам-кандидатам.Mol Plant Microbe Interactive. 2009, 22: 601-615.

    Артикул CAS Google Scholar

  • 17.

    Foster SJ, Park TH, Pel MA, Brigneti G, Sliwka J, Jagger L, van der Vossen EAG, Jones JDG: Rpi-vnt1.1 , гомолог Tm-2 из Solanum venturii, придает устойчивость к фитофторозу картофеля. Mol Plant Microbe Interactive. 2009, 22: 589-600.

    Артикул CAS Google Scholar

  • 18.

    Маллинз Э., Милбурн Д., Петти С., Дойл-Прествич Б.М., Мид С. Картофель в эпоху биотехнологии. Trends Plant Sci. 2006, 11 (5): 254-260.

    Артикул CAS Google Scholar

  • 19.

    Баррелл П.Дж., Мейялаган С., Джейкобс Дж.М., Коннер А.Дж.: Применение биотехнологии и геномики в улучшении картофеля. Plant Biotechnol J. 2013, 11 (8): 907-920.

    Артикул CAS Google Scholar

  • 20.

    Jacobsen E, Schouten HJ: Цисгенез сильно улучшает интрогрессивную селекцию и индуцированную транслокационную селекцию растений. Trends Biotechnol. 2007, 25: 219-223.

    Артикул CAS Google Scholar

  • 21.

    Якобсен Э: Цисгенезис: современный способ приручения признаков генофонда заводчиков. CAB Обзоры. 2013, 8: 56-

    Статья Google Scholar

  • 22.

    Евробарометр: европейцы и биотехнологии в 2010 г .; Ветер перемен?. http://ec.europa.eu/research/science-society/document_library/pdf_06/europeans-biotechnology-in-2010_en.pdf, по состоянию на 13 марта 2014 г.

  • 23.

    Zhu SX, Li Y, Vossen JH, Visser RGF, Якобсен E: Функциональное сочетание трех генов устойчивости против Phytophthora infestans в картофеле. Transgenic Res. 2012, 21: 89-99.

    Артикул CAS Google Scholar

  • 24.

    Pel MA: Картирование, выделение и характеристика генов, ответственных за устойчивость картофеля к фитофторозу. Кандидатская диссертация. 2010, Университет Вагенингена

    Google Scholar

  • 25.

    Уиллер В.А., Эванс Н.Е., Фулгер Д., Уэбб К.Дж., Карп А., Франклин Дж., Брайт С.В.Дж.: Формирование побегов из культур эксплантатов четырнадцати сортов картофеля и исследования цитологии и морфологии регенерированных растений. Энн Бот. 1985, 55 (3): 309-320.

    Google Scholar

  • 26.

    Jacobsen E, Schouten HJ: Цисгенез, новый инструмент для традиционной селекции растений, должен быть освобожден от регулирования генетически модифицированных организмов поэтапно. Potato Res. 2008, 51: 75-88.

    Артикул Google Scholar

  • 27.

    de Vetten NCM, Wolters AMA, Raemakers K, van der Meer I, ter Stege R, Heeres E, Heeres P, Visser RGF: метод трансформации для получения безмаркерных растений перекрестноопыляемых и вегетативных размножаемый урожай.Nat Biotechnol. 2003, 21: 439-442.

    Артикул CAS Google Scholar

  • 28.

    Джоши С.Г .: На пути к устойчивой устойчивости к парше яблони с помощью цисгенов. Кандидатская диссертация. 2010, Университет Вагенингена

    Google Scholar

  • 29.

    Херес П., Шипперс-Розенбум М., Якобсен Э., Виссер RGF: Трансформация большого количества сортов картофеля: генотип-зависимая изменчивость в эффективности и сомаклональная изменчивость.Euphytica. 2002, 124: 13-22.

    Артикул CAS Google Scholar

  • 30.

    Thomas CM, Jones JDG: Молекулярный анализ интеграции Т-ДНК Agrobacterium в томатах показывает роль гомологии последовательности левой границы в большинстве событий интеграции. Mol Genet Genomics. 2007, 278 (4): 411-420.

    Артикул CAS Google Scholar

  • 31.

    Петти С., Вендт Т., Мид С., Маллинз Е. Доказательства зависимости генотипа в пределах Agrobacterium tumefaciens в отношении интеграции последовательности основной цепи вектора в трансгенный Phytophthora infestans -толерантный картофель.J Biosci Bioeng. 2009, 107 (3): 301-306.

    Артикул CAS Google Scholar

  • 32.

    EFSA: Научное заключение, касающееся оценки безопасности растений, полученных путем цисгенеза и внутригенезиса. EFSA J. 2012, 10: 2561-

    Google Scholar

  • 33.

    Murashige T, Skoog F: пересмотренная среда для быстрого роста и биоанализов с культурами тканей табака. Physiol Plant.1962, 15: 473-497.

    Артикул CAS Google Scholar

  • 34.

    Vleeshouwers VGAA, Van DW, Keizer LC P, Sijpkes L, Govers F, Colon LT: лабораторный анализ устойчивости Phytophthora infestans у различных видов Solanum отражает полевую ситуацию. Eur J Plant Pathol. 1999, 105: 241-250.

    Артикул Google Scholar

  • 35.

    de Vetten NCM, Visser RGF, Jacobsen E, van der Vossen EAG, Wolters AMA: использование генов R в качестве селективного маркера при трансформации растений и использование цисгенов при трансформации растений.заявка на патент, опубликованная: IPO: WO 20080

    A1

  • 36.

    Visser RGF: Регенерация и трансформация картофеля с помощью Agrobacterium tumefaciens . Руководство по культуре тканей растений. Под редакцией: Линдси К. 1991, Дордрехт, Бостон, Лондон: Kluwer Academic Publishers, 1-9.

    Google Scholar

  • 37.

    Vleeshouwers VGAA, Rietman H: В системах экспрессии planta. Генетика и геномика оомицетов. Под редакцией: Ламур К.Х., Камун С.2009, Хобокен, Нью-Джерси: John Wiley & Sons, 455-475.

    Глава Google Scholar

  • 38.

    Huang S, van der Vossen EAG, Kuang H, Vleeshouwers VGAA, Zhang N, Borm TJA, van Eck HJ, Baker B, Jacobsen E, Visser RGF: Сравнительная геномика позволила выделить R3a поздно ген устойчивости картофеля к фитофторозу. Плант Дж. 2005, 42: 251-261.

    Артикул CAS Google Scholar

  • 39.

    Armstrong MR, Whisson SC, Pritchard L, Bos JIB, Venter E, Avrova AO, Rehmany AP, Bohme U, Brooks K, Cherevach I, Hamlin N, White B, Fraser A, Lord A, Quail MA, Churcher C, Hall N, Berriman M, Huang S, Kamoun S, Beynon JL, Birch PRJ: Локус предкового оомицета содержит ген авирулентности фитофтороза Avr3a , кодирующий белок, который распознается в цитоплазме хозяина. Proc Natl Acad Sci USA. 2005, 102: 7766-7777.

    Артикул CAS Google Scholar

  • 40.

    Карими М., Инзе Д., Депикер А: векторы GATEWAY ™ для трансформации растений, опосредованной Agrobacterium . Trends Plant Sci. 2002, 7: 193-195.

    Артикул CAS Google Scholar

  • 41.

    Fulton T, Chunwongse J, Tanksley S: Протокол Microprep для экстракции ДНК из томатов и других травянистых растений. Завод Мол Биол Реп. 1995, 13: 207-209.

    Артикул CAS Google Scholar

  • Вопросы и ответы с Хейвен Бейкер о Simplot’s Innate ™ Potatoes

    Хейвен Бейкер, вице-президент по наукам о растениях в J.R. Simplot Company
    В городе появился новый генно-инженерный картофель, который не подрумянивается при резке или жарке и не производит акриламид. Компания J. R. Simplot подала прошение в Министерство сельского хозяйства США о дерегулировании их картофеля Innate ™, и только что начался период общественного обсуждения этой петиции. Мы отправили Simplot несколько вопросов об их молодом картофеле и технологии, используемой для его производства, и их вице-президент по наукам о растениях Хейвен Бейкер был рад ответить. Вот это интервью, и если у вас есть еще вопросы по нему, не стесняйтесь спрашивать больше, поскольку мы попросили Хейвена остаться для обсуждения.
    1. Расскажите о новых врожденных чертах картофеля? Как было решено, что над этими чертами важно работать?
    Совершенно верно. Simplot – это новаторская картофелеводческая и пищевая компания. Имея более чем 60-летний опыт работы в картофельном бизнесе, мы знаем о ряде важных областей, в которых биотехнология может принести пользу многим организациям, составляющим пищевую цепочку картофеля. Уловка всегда заключается в том, чтобы сопоставить то, что возможно с научной точки зрения, с тем, что имеет смысл для бизнеса. Мы считаем, что производители семян, фермеры, переработчики и потребители могут извлечь выгоду из уменьшения количества синяков в виде черных пятен, низкого содержания аспарагина и медленного разложения крахмала до сахаров во время хранения.
    Мы знаем, что восприимчивость картофеля к образованию черных пятен от ударов и давления во время сбора урожая и хранения приводит к значительным потерям продукта. Таким образом, уменьшение количества черных пятен от синяков на картофеле Innate ™ приведет к увеличению полезного урожая, что сделает выращивание картофеля более прибыльным. Пониженный сахар – при определенных условиях – обеспечивает устойчивый золотистый цвет, обеспечивая идеальный вкус и текстуру. Снижение уровня аспарагина снижает потенциальное образование акриламида, химического соединения, которое возникает при приготовлении картофеля, пшеницы, кофе и других продуктов при высоких температурах.В Калифорнии картофель Innate ™ является потенциальным средством для переработчиков картофеля для решения проблем с акриламидом в соответствии с Предложением 65.
    2. Кажется, что «врожденный» – это больше, чем просто признаки, но это технология для привнесения многих свойств в картофель. Вы можете рассказать нам, как это работает? Это внутригенный / цисгенный? Почему вы выбрали название «Врожденный»?
    Мы подумали, что «врожденная» технология является подходящим термином из-за врожденной природы передачи ДНК картофеля растению картофеля.Технологии Simplot’s Innate ™ позволяют исследователям выделять генетические элементы из генома любого растения, переупорядочивать их или связывать вместе в желаемых перестановках и вводить их обратно в геном. Вставка дополнительной копии гена в картофель активирует механизм самозащиты, известный как РНК-интерференция, который заглушает гены, связанные с экспрессией синяков черных пятен, аспарагина и восстанавливающих сахаров в клубнях.
    Вставленные гены происходят из культурного или дикого картофеля (группа родственных видов растений, сексуально совместимых с картофелем).Мы не включаем чужеродные гены, маркеры устойчивости к антибиотикам и последовательности скелета вектора в геном растения. Мы использовали вектор pSIM1278, который включает в себя две «кассеты» сайленсинга в картофеле. Экспрессия первой кассеты снижает уровни транскриптов для генов Asn1 (аспарагинсинтетаза-1) и Ppo5 (полифенолоксидаза-5) и, следовательно, ограничивает образование предшественника акриламида аспарагина и образование синяка в виде черной точки, вызванного ударами, который происходит, когда фермент полифенолоксидаза окисляет фенолы с образованием темных пигментов.Наличие синяков в виде черных пятен приводит к снижению качества и последующим потерям продукции при переработке в картофель фри или чипсы.

    Снижение образования редуцирующих сахаров достигается за счет подавления уровней транскриптов для генов PhL (фосфорилаза-L) и R1 (связанный с крахмалом), возникающих в результате экспрессии второй кассеты. Эти свойства действуют, замедляя превращение крахмала в восстанавливающие сахара (глюкозу и фруктозу). Преимущества включают улучшенное качество, особенно в том, что касается контроля цвета, и, таким образом, способствование желаемым золотисто-коричневым цветам, необходимым большинству покупателей картофеля фри или чипсов.Кроме того, восстанавливающие сахара реагируют с аминокислотами, такими как аспарагин, с образованием продуктов Майяра, включая акриламид. Таким образом, снижая уровень этих сахаров в хранящемся картофеле, мы можем значительно снизить уровень токсичного акриламида в пище.

    Акриламид образуется при нагревании аспарагина до высоких температур (например, при жарке) в присутствии некоторых сахаров. Меньше аспарагина и сахара – меньше акриламида.
    3. Сколько и какие разновидности были преобразованы с новыми признаками, и проводилась ли каждая трансформация отдельно?
    Мы преобразовали пять различных разновидностей, включая три популярных разновидности – Ranger Russet, Russet Burbank и Atlantic – и две запатентованные разновидности для чипирования.Каждый из этих сортов включал трансформацию по двум признакам (гены, связанные с экспрессией синяка с черными пятнами и аспарагина, и гены, связанные с восстановлением сахара в клубнях) в общей сложности десяти событий, которые были выполнены отдельно.
    4. Можно ли запекать, жарить или готовить врожденный картофель, как обычный картофель? Отличаются ли они вкусовыми качествами после приготовления от обычного картофеля?
    Да. В ходе обширных полевых испытаний и последующих дегустационных исследований было установлено, что картофель Innate ™ выглядит, вкус и имеет такую ​​же текстуру, что и его коммерческие аналоги, выращенные традиционным способом, и его можно готовить точно так же.Однако из-за того, что они не потемнели, их больше не нужно замачивать после резки, чтобы предотвратить потемнение (для тех, кто это делал раньше).
    5. Как долго не подрумянившийся картофель сохраняется после разрезания по сравнению с обычным картофелем? Поможет ли врожденный картофель сократить количество пищевых отходов?
    Картофель Innate ™ и обычный картофель через 10 часов после нарезки.
    Картофель Innate ™ не станет коричневым после резки в течение многих дней, пока он не высохнет и не разложится естественным образом, в то время как обычный картофель часто начинает коричневеть в течение десяти минут.Очевидные признаки деградации картофеля из-за фитофтороза, гнили или вируса все еще будут проявляться у картофеля Innate ™ на поздних стадиях, и они будут обнаружены в ходе нормального контроля качества на уровне производителя или переработчика, поскольку картофель обычно хранится после сбора урожая. На ранних стадиях роста большинство традиционных сортов картофеля не экспрессируют фермент полифенолоксидазы (РРО), который вызывает потемнение при разрезании или повреждении, поэтому Innate ™ не будет исключением.
    (Примечание редактора: это тот же ген и механизм, которые были изменены, чтобы сделать арктические яблоки без коричневого цвета.)
    Что касается пищевых отходов, почернение, возникающее после того, как картофель поврежден, влияет на качество и восстановление при переработке картофеля фри и чипсов – по данным отрасли, в плохие годы это может составлять более 5% от всех загрузок. Пораженный картофель необходимо обрезать или отбраковывать перед переработкой, что приведет к ухудшению качества или экономическим потерям. Фактически, некоторые переработчики отказываются от загрузки с понижением содержания сахара выше 2%, что, как мы понимаем, может составлять до 20% произведенного картофеля.Однако картофель Innate ™ демонстрирует значительно меньшее количество черных пятен и более низкое содержание редуцирующего сахара, что может сэкономить производителям и переработчикам десятки миллионов долларов.
    6. Сколько картофеля теряется во время и после сбора урожая из-за синяков и черных пятен?
    Ответ на этот вопрос сложнее, чем кажется. Погода, температура почвы, условия хранения и различные сорта картофеля могут повлиять на синяк от черной точки. Он может значительно меняться от года к году.Тем не менее, что касается пищевых отходов, переработчики и производители говорят нам, что низкий уровень синяков в виде черных пятен приведет к экономии до 5% забракованных грузов, что значительно сократит количество послеуборочных отходов.
    7. Какие усилия были предприняты для достижения этих качеств с помощью традиционного разведения? Существуют ли какие-либо препятствия на пути развития этих черт путем разведения?
    При традиционном селекции растений были предприняты усилия по снижению содержания акриламида и уничтожению вирусов и вредителей растений, однако прогресс был медленным, и до коммерческих решений еще много лет.Сегодняшние традиционные методы разведения просто приводят к случайным перестройкам генома и сегрегации признаков и не позволяют одновременно добавлять несколько желаемых признаков.
    В настоящее время нет доступных сортов, которые дают клубни с низким потенциалом акриламида, уменьшенным пятном синяков и пониженным содержанием сахара, но демонстрируют все другие признаки, важные для пищевой промышленности. Поэтому вместо того, чтобы пытаться вывести новые сорта, компания J. R. Simplot улучшила качество пяти существующих сортов картофеля, преобразовав их с помощью технологии Innate ™.
    Трансформированный картофель Innate ™ в питательной среде
    Поскольку наши технологии Innate ™ эффективно ускоряют процесс обычного скрещивания, он позволяет желаемым изменениям в традиционных сортах происходить намного быстрее, чем это возможно в настоящее время, при сохранении желаемых характеристик исходного родительского растения. Для картофеля технологии Innate TM особенно привлекательны, потому что картофель известен своей высокой степенью гетерозиготности, страдает от депрессии инбридинга и ограничивается преимущественно клональным размножением.Эти неотъемлемые факторы значительно мешают нам внедрять в коммерческих целях качественные, востребованные черты в эту ценную культуру.
    (Примечание редактора: посмотрите это видео, чтобы увидеть, как разводят картофель.)
    8. Каков текущий нормативный статус врожденного картофеля в США и других странах?
    Simplot инициировал одобрение регулирующих органов USDA в январе 2013 года, и общественное обсуждение сейчас открыто и продлится до 2 июля. Мы надеемся, что одобрение будет получено в следующем году.Кроме того, мы инициировали процесс добровольной проверки безопасности FDA и должны получить одобрение уже этой осенью. В настоящее время мы добиваемся разрешения регулирующих органов на зарубежных экспортных рынках в Канаде, Мексике, Южной Корее и Японии.
    9. Будет ли врожденный картофель продаваться только коммерческим производителям или он также будет доступен для выращивания домашними садоводами? Увидим ли мы в супермаркете «Врожденный картофель» или он предназначен только для переработчиков?
    После утверждения картофель Innate ™ первоначально будет доступен коммерческим производителям из-за ограниченного количества мини-клубней, используемых в качестве семян.Мы изучаем возможность продавать этот картофель в супермаркетах в будущем. В ближайшее время домашним садоводам они, скорее всего, будут недоступны.
    10. Какие виды оценки безопасности были проведены для врожденного картофеля? Как мы узнаем, какое влияние они окажут на окружающую среду или здоровье человека? Насколько беспокоит перекрестное опыление?
    Картофель выращивают из семенного картофеля, который является клонами своих родителей.Никакого опыления!
    Процесс проверки безопасности USDA обширен и включает экологическую оценку с результатами широко распространенных полевых испытаний. Эти полевые испытания демонстрируют, что картофель Innate ™ не представляет опасности для здоровья или окружающей среды, не причиняет вреда другим видам и растет так же, как обычный картофель, без использования специальных пестицидов или удобрений. Риск перекрестного опыления практически отсутствует, поскольку коммерческий картофель выращивают из клубней, а не семян.Кроме того, многие коммерческие сорта картофеля либо стерильны, либо несовместимы с диким картофелем по половому признаку. Дикий картофель встречается редко, а пчелы не посещают цветы из-за недостатка нектара.
    Параллельный анализ картофеля Innate ™, проводимый Управлением по контролю за продуктами и лекарствами (FDA), который также проводится, гарантирует, что он безопасен для употребления. Хотя представление FDA является добровольным, мы считаем его рассмотрение важным подтверждением безопасности пищевых продуктов. Обширные испытания Simplot показывают, что этот картофель имеет те же питательные вещества, вкус и внешний вид, что и обычные сорта картофеля, безопасность которых доказана на протяжении многих лет.
    Кроме того, мы проводим обширные внутренние проверки безопасности последовательностей соединений наших линий Innate ™, наряду с оценкой потенциальных открытых рамок считывания и аллергенов. Например, плазмида pSIM1278 была вставлена ​​с сохранением всех кассет экспрессии. Анализ областей вставки и соединения не показывает никаких новых белков или аллергенов, которые могли бы изменить безопасность линий Innate ™ по сравнению с родительскими разновидностями. Дополнительные доказательства того, что нормальные характеристики картофеля в отношении вкуса и роста растений не изменились, были предоставлены в исследованиях агрономии и состава, представленных в USDA и FDA.
    11. Какая работа была проделана по оценке отношения потребителей к этому картофелю? Доступны ли детали исследования приемки для изучения людьми или оно будет опубликовано?
    За последние несколько лет было проведено несколько потребительских исследований. Международный совет по информации о продуктах питания (IFIC) провел некоторое исследование отношения потребителей к биотехнологическим продуктам питания в целом. По данным IFIC, 69% потребителей с большой или некоторой вероятностью примут овощи, полученные с использованием биотехнологий, включая картофель, если они вкуснее или свежее.
    Кроме того, Simplot заказала собственное исследование, доступное в ее брошюрах и на веб-сайте, которое показывает, что одобрение Innate ™ потребителями (93%) аналогично традиционному селекции растений (94%).
    12. Похоже, что пониженный уровень аспарагина ( и, возможно, даже не коричневый цвет ) может быть важен для потребителей. Как они смогут узнать об этих различиях при покупке конечных продуктов, будь то цельный картофель, чипсы, картофель фри и т. Д.?
    После утверждения картофель Innate ™, содержащий низкое содержание акриламида, будет доступен в ограниченном количестве в 2014 году. В 2015 году Simplot увеличит предложение семян Innate ™ для удовлетворения ожидаемого рыночного спроса. При необходимости Simplot будет работать с процессорами чипов, свежих продуктов и жареных продуктов, чтобы сообщать о преимуществах.
    13. Что о них думают фермеры?
    Несколько фермеров участвовали в полевых испытаниях, и многие другие посетили дни брифингов, чтобы увидеть результаты.Они сказали нам, что очень довольны результатами, в которых картофель Innate ™ имеет те же вкусовые качества и ростовые характеристики, что и его коммерчески выращиваемые аналоги, и содержит товарные черты с низким содержанием аспарагина, меньшим количеством синяков в виде черных пятен и низким содержанием восстанавливающих сахаров.
    Один крупный фермер, который видел наши полевые испытания, Дуэйн Грант, недавно написал о них редакционную статью в Truth About Trade & Technology.
    14. Какие еще черты характера, которые развивает Simplot, мы можем увидеть в будущем?
    Эта технология открывает большие перспективы для улучшения урожая в будущем.Simplot Plant Sciences планирует добавить преимущества текущим линиям картофеля Innate ™, различным сортам картофеля и даже другим культурам. Наше второе поколение биотехнологического картофеля будет лучше хранить и уменьшать содержание акриламида до 90%. У нас есть активная программа исследований и мы работаем над вирусом Y картофеля, улучшением устойчивости к фитофторозу и другими характеристиками здоровья потребителей, такими как повышенное содержание витаминов или питательных веществ. Благодаря безграничным возможностям технологии Innate ™ мы стремимся создавать лучшие фрукты и овощи, улучшать сельское хозяйство и здоровье человека.
    –Haven Baker
    Не стесняйтесь задавать дополнительные вопросы, и если вы хотите прокомментировать ходатайство о дерегулировании, вы можете сделать это здесь. Спасибо, Хейвен, за то, что нашли время ответить на эти вопросы для наших читателей, и Джули Салли за помощь в организации интервью.
    Обновление от 9 мая 2013 г .: Хейвен Бейкер вчера встретил Фрэнка! Вот фото.

    Экспрессия эритропоэтина в индийском тетраплоиде …

    Введение

    В последнее десятилетие системы экспрессии трансгенных растений стали серьезной конкурентной силой в крупномасштабном производстве рекомбинантных белков.Первые гетерологичные белки растительного происхождения уже поступили на рынок 1,2 , и подробные экономические оценки продемонстрировали их конкурентоспособность по сравнению с существующими рыночными секторами 3,4 . Некоторые рекомбинантные терапевтические белки растительного происхождения, которые находятся на заключительной стадии клинических испытаний, включают продукты крови человека, вакцину, антитела и гормоны роста 5 . Как и в случае с рядом продуктов, поступающих на рынок, молекулярное земледелие в растениях, наконец, достигает зрелости.Были технологические разработки на многих уровнях, включая методы трансформации, контроль экспрессии генов, нацеливание и накопление белков, использование различных культур в качестве производственных платформ 6 и модификации для изменения структурных и функциональных свойств продукта. Одним из наиболее движущих факторов было повышение урожайности, поскольку выход продукта оказывает значительное влияние на экономическую целесообразность. Для увеличения конечной урожайности можно использовать несколько подходов. Одним из них является использование тканеспецифического промотора, который может концентрировать интересующий белок в ткани-мишени и оказаться полезным при последующей очистке 7 .

    В настоящем отчете был составлен протокол экспрессии терапевтических белков в клубнях картофеля с использованием пататина, специфичного для клубней промотора. Индийский сорт тетраплоидного картофеля Kufri Bahar использовался для экспрессии терапевтического белка, так как он широко выращивается в Гуджарате и других регионах Индии. Картофель – это вегетативно размножаемое растение, что сводит к минимуму распространение трансгенного загрязнения через пыльцу, а высокая биомасса клубней делает его пригодным для массового производства 8 .

    Эритропоэтин (ЭПО) был выбран в качестве белка, представляющего интерес для специфической для клубней экспрессии и для оценки способности выполнять комплексное гликозилирование в растении картофеля. Эритропоэтин является сильно гликозилированным белком, и гликозилирование необходимо для его активности in vivo 9 . В настоящее время доступный на рынке рекомбинантный эритропоэтин получают из клеток млекопитающих. Системы для млекопитающих имеют недостатки с точки зрения стоимости, масштабируемости и безопасности 10,11 .Рекомбинантный эритропоэтин человека широко используется для лечения анемии, связанной с хронической почечной недостаточностью, ревматоидным артритом, синдромом приобретенного иммунодефицита (СПИД) и злокачественными новообразованиями, а также с другими типами анемии 12 .

    Рекомбинантный ЭПО экспрессировали в клетках табака BY2. Однако уровень экспрессии был очень низким (0,0026%), и экспрессированный белок оставался активным только in vitro 13 . Таким образом, чтобы увеличить экспрессию, исследователи пытались экспрессировать этот белок во всем растении, используя конститутивный промотор (табак и Arabidopsis), где наблюдался побочный эффект сверхэкспрессии 14 .Сверхэкспрессия белка ЕРО приводила к задержке вегетативного роста, позднему цветению и мужской стерильности 15 .

    В то время как в настоящем проекте мы выбрали экспрессию белка ЭПО тканеспецифическим образом, используя тканеспецифический подход, мы стремились снизить метаболическую нагрузку на все растение и сконцентрировать белок в целевой ткани, где он легко очищается. В настоящем исследовании клубни картофеля были выбраны в качестве органа выбора для производства ЭПО, поскольку те же стандартные процессы, которые используются в крахмальной промышленности, могут быть адаптированы с небольшими изменениями для разделения белков.Кроме того, клубни, как и большинство запасающих органов, обладают низким гидролитическим профилем, что способствует стабильности белка.

    Несколько генов были экспрессированы в клубнях картофеля с использованием различных методов с разной степенью успеха 15–17 . Значительный успех был достигнут с промотором пататина, который придает клубень специфичности 16,18 . В большинстве отчетов, в которых клубень картофеля используется в качестве экспрессора терапевтических белков, обычно используется диплоидный сорт картофеля 19–23 .Однако мы стремимся использовать индийский сорт тетраплоидного картофеля Kufri Bahar , который широко выращивается в Гуджарате и других частях Индии 24 .

    Материалы и методы

    Плазмиды, бактериальные штаммы и растения

    В настоящем отчете использовались плазмиды, бактериальные штаммы и растения, как описано в таблице 1.

    Таблица 1. Плазмиды, бактериальные штаммы и сорта растений, используемые в эта учеба.

    11 pBinB33
    pCAMBIA Промо-тин 11 pIRS Содержит
    D-вектор 11 pIRS EPO ген
    Плазмиды / бактериальные штаммы Свойства / Назначение Источник
    pBinB33
    pCAMBIA 12poZ
    Gifted Dr.Фредерик Борнке, Германия
    Получено из КАМБИИ, Австралия
    Подарено доктором Кириллом Александровым, Германия
    E. coli DH5α
    E. coli HB101
    Agrobacterium tumefaciens LBA 4404
    Использование для клонирования все плазмиды
    Используется в качестве вспомогательной плазмиды в трехродительской конъюгации
    Обезоруженные штаммы
    BV Patel PERD center’s Depository
    Приобретено в DSMZ, Германия
    Получено из коллекции культур Нидерландов (NCCB), Нидерланды
    Разновидность растений
    Tuberoshar Solanum )
    Используется в качестве хозяина экспрессии для гена EPO Подарено Dr.N.H. Patel (Исследовательская станция картофеля, DISA)

    Выращивание и поддержание бактериальных культур

    Культуры Escherichia coli DH5α и Agrobacterium LBA4404 выращивали в среде бульона с лурией (LB). культур E. coli выращивали при 37 ° C, а культур Agrobacterium выращивали при 28 ° C при 175 об / мин. При необходимости добавляли антибиотики для E. coli (хлорамфеникол [Sigma] 35 мг / мл) и для Agrobacterium (хлорамфеникол 35 мг / мл и рифампицин [Hi-media] 50 мг / мл).

    Конструирование растительных векторов экспрессии rEPO

    Все ферменты, которые использовали для клонирования, были приобретены у MBI fermentas. Клубень-специфический промотор пататин (В33) был вырезан из вектора pBinB33 с использованием сайтов рестрикционной эндонуклеазы (RE) Eco RI и Bam HI и клонирован в бинарный вектор pCAMBIA1281Z с использованием тех же сайтов RE. pCAMBIA1281Z содержал GUS в качестве репортерного белка. Ген пататина был клонирован выше гена GUS по сайтам Eco RI и Bam HI RE, в результате была получена плазмида, названная pPERDB33 (рис. 1а).Для экспрессии гена EPO последовательность кДНК EPO была вырезана из pIRsepo и клонирована в pPERDB33 вместо гена GUS с использованием сайтов Nco I и Bst EII RE (рис. 1b). Полученная плазмида была названа pPERDB33cEPO, в которой ген ЕРО расположен ниже промотора пататина (рис. 1b). Затем pPERDB33cEPO вводили в E. coli DH5α для поддержания и дальнейшего экспериментирования. pPERDB33cEPO был также введен в штамм Agrobacterium tumefaciens LBA 4404 с использованием трех родительского скрещивания 25 .

    Рис. 1. Схематическая диаграмма конструкции вектора для тканеспецифической экспрессии гена ЭПО в растениях картофеля.

    a ) Конструирование вектора, содержащего пататин, pPERDB33 и b ) конструирование вектора, содержащего ген EPO, под промотором пататина.

    Создание

    культур картофеля in vitro

    Побеговые культуры сорта Куфри Бахар были выведены из проросших почек, удаленных с клубней.Поверхность бутонов стерилизовали 0,1% хлоридом ртути в течение 3 мин с последующей промывкой 70% этанолом. После повторной промывки стерильной дистиллированной водой почки культивировали на среде Мурашиге и Скуга (MS) с добавлением 0,1 мкМ GA 3 . PH среды доводили до 5,7, и все культуры затвердевали с 0,8% агарозы. Культуры подвергали воздействию света в течение 16 часов, что обеспечивало интенсивность света 1600 люкс, и выдерживали при температуре 24 ± 2 ° C и относительной влажности 50-60%.Почки превратились в ростки за 4 недели. Узлы этих проростков культивировали на среде MS, содержащей 3% сахарозы, для выращивания свежих культур. Всходы свежих культур культивировали в среде MS с добавлением 8% сахарозы и 6 мкМ BA для получения микроклубней. Межузловые сегменты, листовые диски и микроклубнеплоды обычно использовали для трансформации, опосредованной Agrobacterium . Для выращивания побегов из межузловых сегментов использовали листовые диски и диски микроклубеньков.Прямая регенерация побегов наблюдалась во всех трех эксплантах в двухстадийной среде. На этапе 1 все эксплантаты инокулировали в среду PSRI 1 (среда MS + 1 мг / л тиамина + 2% сахарозы + 11 мкМ зеатин + 1 мкМ NAA + 0,05 мкМ GA 3 + 0,8% агар) на 20-30 дней и затем переносили на среду PSRI 2 (среда MS + 1 мг / л тиамина + 2% сахарозы + 9 мкМ зеатин + 0,1 мкМ NAA + 0,05 мкМ GA3). Эта среда была стандартизирована для прямой регенерации побегов из междоузлий Миллэмом (2006) 26 .

    Трансформация растений картофеля

    Межузловые сегменты, листовые диски и микроклубнеплоды у растений, выращенных in vitro, для трансформации и регенерации использовали растений, по существу, как описано Millam (2006) 26 с некоторыми модификациями. Процедура, описанная Millam (2006) 26 для междоузлий, также использовалась для дисков листьев, а также дисков микроклубней. Все три эксплантата инкубировали в жидкой среде для регенерации побегов (среда MS, содержащая 1 мг / л тиамина + 2% сахарозы + 11 мкМ зеатин +1 мкМ NAA + 0.05 мкМ GA 3 ) в течение 2–3 часов в присутствии 20 мкМ ацетосирингона. После предварительной обработки эксплантаты инфицировали Agrobacterium tumefaciens, LBA4404, несущей pPERDB33cEPO, в течение 15 минут. Затем эксплантаты промокали насухо на стерильной фильтровальной бумаге ватман № 1 и совместно культивировали на среде для регенерации побегов, содержащей 0,8% агара, в течение 2 дней. После совместного культивирования эксплантаты переносили в среду для регенерации побегов, содержащую 0,8% агара и 500 мг / мл цефотаксима, на 7 дней для ингибирования роста Agrobacterium .Через 7 дней эксплантаты переносили в среду для регенерации побегов, содержащую 0,8% агар, 500 мг / мл цефотаксима и 7,5 мг / мл гигромицина, для отбора трансгенных побегов.

    Анализ трансгенных растений

    После отбора трансформированного растения в среде для отбора антибиотиков геномную ДНК выделяли с использованием свежего листа из регенерированных побегов 27 . Геномную ДНК использовали в качестве ДНК-матрицы для амплификации гена cEPO. После трансформации Т-ДНК была интегрирована в ядерную ДНК растений.Чтобы подтвердить присутствие кДНК-последовательности ЕРО в ядерной ДНК растений, была проведена ген-специфическая ПЦР с использованием кДНК-специфического праймера ЕРО, прямого праймера: 5 ’CCACCACGCCTCATCTGTGAC 3’ и обратного праймера 5 ’TCTGTCCCCTGTCCTGCAGGC 3’. ПЦР-амплификацию проводили в 50 мкл реакционной смеси, содержащей праймеры (50 нг каждый), ДНК-полимеразу Taq (1 единица), 200 мкМ dNTP, 1 × буфер для ПЦР и 50 нг геномной ДНК в качестве матрицы для амплификации фрагмента гена EPO размером 408 п.н. Условия цикла ПЦР были установлены как начальное плавление при 95 ° C в течение 5 минут с последующими 30 циклами амплификации, каждый цикл состоял из следующих этапов: 95 ° C в течение 15 секунд, 68 ° C в течение 20 секунд и 72 ° C в течение 1 минута.

    Результаты

    Для получения белка ЕРО специфическим для клубней образом промотор пататина сначала вырезали и лигировали в основной вектор pCAMBIA1281Z для получения pPERDB33. Подтверждение pPERDB33 было выполнено перевариванием RE и электрофорезом в агарозном геле (рис. 2).

    Фигура 2. Подтверждение трансформанта двойным перевариванием RE.

    Дорожка 1 содержит маркер (ДНК ламда, расщепленная Hind III), дорожка 2 содержит Eco RI и Bam HI плазмиду из клона 23, дорожка 3 содержит Eco RI расщепленную плазмиду из клона 23, дорожка 4 содержит непереваренную плазмиду из клона 23, дорожка 5 содержит Eco RI и Bam HI плазмиду из клона 26, дорожка 6 содержит расщепленную Eco RI плазмиду из клона 26, дорожка 7 содержит непереваренную плазмиду из клона 26, дорожка 8 содержит непереваренная pCAMBIA 1281Z, дорожка 9 содержит EcoBinB33, переваренная RI, дорожка 10 содержит EcoBamBIA 1281Z и Bam HI, переваренная pCAMBIA 1281Z, дорожка 11 содержит непереваренный pBinB33, дорожка 12 содержит EcoBinB33, переваренная дорожка 12 Eco RI и Bam HI, расщепленная pBinB33, и дорожка 14 содержит маркер (ДНК лямда, расщепленная с помощью Bst EII).

    После подтверждения того, что правый клон, имеющий суфлер пататина перед геном GUS, сохранялся в E. coli . Метод, опосредованный Agrobacterium , использовали для экспрессии гена ЕРО в растении картофеля. Плазмида pPERDB33, которая содержит ген GUS ниже по ходу от промотора пататина, была мобилизована в Agrobacterium LBA4404 с использованием трех родительского спаривания и подтверждения правого клона, который был отобран на чашке с агаром Лурия, содержащим рифампицин и хлорамфеникол, и был выполнен тот же метод использовался для отбора правильного клона у E.coli .

    Для клонирования белка ЕРО в вектор pPERDB33 ниже промотора пататина последовательность кДНК гена ЕРО человека вырезали из плазмиды pRISepo и лигировали с плазмидой pPERDB33 вместо GUS. Подтверждение правильного клона было выполнено перевариванием RE и электрофорезом в агарозном геле (рис. 3). Полученная плазмида, которая имеет ген ЕРО ниже промотора пататина, была названа pPERDB33cEPO. Затем pPERDB33cEPO был мобилизован на Agrobacterium LBA4404 с использованием трех родительского скрещивания и подтвержден перевариванием RE и электрофорезом в агарозном геле.

    Фигура 3. Подтверждение трансформанта (pPERDB33cEPO) перевариванием RE.

    Дорожка 1 содержит маркер (ДНК lamda, расщепленная маркером Hind III из MBI Fermentas), дорожка 2 содержит pRIsepo, расщепленную Nco I и Bst EII, дорожка 3 содержит pPERDB33, расщепленную Nco I и Bst EII и дорожки с 4 по 8 содержат положительные клоны ПЦР.

    Полученную плазмиду pPERDB33cEPO затем вводили в растения картофеля с использованием трансформации, опосредованной Agrobacterium .Трансформированные растения отбирали на среде PSRI, содержащей 7,5 мг / л гигромицина и 500 мг / л цефотаксима. Через 1 месяц на дисках микроклубней в среде для отбора антибиотиков наблюдали образование трансгенных побегов (рис. 4). Однако образование побегов наблюдалось и у межузловых эксплантатов, но они не выживали в течение более длительного времени в стрессовой среде с антибиотиками.

    Рис. 4. Стрельба из преобразованных дисков микроклубней.

    Геномную ДНК выделяли из листа трансформированного растения.Относительное количество и качество геномной ДНК анализировали с помощью электрофореза в агарозном геле. После трансформации растения методом Agrobacterium сегмент Т-ДНК, содержащий ген ЕРО, был интегрирован в ядерный геном растения. Чтобы исследовать стабильную интеграцию интересующего гена в ядерный геном растения, была проведена ген-специфическая ПЦР. Изолированную геномную ДНК трансформированного растения использовали в качестве ДНК-матрицы. Для ген-специфичного ПЦР-анализа использовали ЕРО, специфически примированный вместе с плазмидной ДНК, содержащей последовательность ЕРО (pPERDB33cEPO) в качестве положительного контроля.

    После амплификации ПЦР продукт ПЦР анализировали с использованием 1,5% агарозного геля (рис. 5). В качестве маркера использовали лестницу ДНК размером 100 п.н. Полоса 408 п.н., соответствующая ампликону ЭПО, наблюдалась в геле (фиг. 5, дорожка 4), которая была аналогична ампликону, полученному из pPERDB33cEPO, используемого в качестве положительного контроля (фиг. 5, дорожка 5). На основании этого результата было подтверждено, что последовательность ЕРО была успешно интегрирована в ядерный геном растения.

    Фигура 5. Анализ ПЦР-положительных трансформированных растений на 1.5% агарозный гель.

    Дорожка 1 содержит геномную ДНК, выделенную из трансформированного растения 1, дорожка 2 содержит лестницу ДНК в качестве маркера (100 п.н. MBI-ферменты), дорожка 3 и дорожка 4 содержат продукт ПЦР трансформированных растений, дорожка 5 содержит положительный контроль (продукт ПЦР pPERDB33cEPO ), дорожка 6 содержит отрицательный контроль (продукт ПЦР pBSSK, который не содержит гена ЕРО), дорожка 7 содержит отрицательный контроль реакции ПЦР (мастер-микс), а дорожка 8 содержит изолят геномной ДНК из трансформированных растений.

    Обсуждение

    Целью настоящего исследования было разработать протокол для производства гетерологичных белков в клубнях картофеля.Векторы для продукции гена эритропоэтина под тканеспецифическим промотором и методы культуры ткани для регенерации целого трансгенного растения картофеля из отдельных эксплантатов были успешно стандартизированы. Была успешно достигнута прямая регенерация побегов из ряда эксплантов, таких как листовые диски, in vivo, клубневых дисков, in vitro, клубневых дисков и междоузлий. При трансформации растений, опосредованной Agrobacterium , наблюдали очень низкую эффективность трансформации растений и высокий процент некроза.Чтобы уменьшить некроз эксплантатов и увеличить время эффективности трансформации при совместном культивировании, были оптимизированы инокуляты бактерий, а также время предварительного отбора. Гигромицин, который использовали в селекционной среде, вызывал некроз эксплантатов даже при более низких концентрациях. Трансгенные растения картофеля были подтверждены с помощью ген-специфической ПЦР, которая доказала, что наш интересующий ген успешно интегрирован в желаемый ядерный геном растения.

    Добавить комментарий

    Ваш адрес email не будет опубликован.